Abstract
Even though seaweeds have been recognized as key players in the ocean-to-atmosphere transfer of iodine in other parts of the world, there is a complete lack of knowledge about iodine accumulation in seaweeds of the Arabian Gulf. Similarly, very little is known about fluorine in seaweeds, anywhere in the world. Given that the Arabian Gulf is of particular interest due to being an extreme environment, featuring some of the highest temperatures and salinities observed in any marine water body worldwide, this study endeavoured to conduct a preliminary survey of iodine and fluorine levels in 11 of the most common seaweed species in the region, supported by morphological and molecular (DNA barcode)-based identification. Iodine was determined by inductively-coupled plasma-mass spectrometry, while ion chromatography was employed for analysis of fluoride. Species surveyed included Iyengaria stellata, Padina boergesenii, Chondria sp.Dictyota dichotoma, Colpomenia sinuosa, Feldmannia indica,Codium papillatum, Sargassum ilicifolium, S. ilicifolium var. acaraeocarpum, Sargassum asperifolium and Sargassum aquifolium. The findings of S. ilicifolium and S. ilicifolium var. acaraeocarpum reported here are new records both for Kuwait and the Arabian Gulf. P. boergesenii and D. dichotoma are new records for Kuwait.
1 Introduction
The discovery of iodine (atomic number 53, with an atomic weight of 126.9 Da) is credited to Courtois in 1811, who was trying to manufacture saltpetre (needed to make gunpowder in the context of the Napoleonic wars) from seaweed ash. After the initial discovery, Joseph Gay-Lussac, another French chemist, gave the new element its name iodine (from the Greek word “ιώδης” due to its purple colour; historical details reviewed by Küpper et al. 2011). Iodine levels are much higher in seawater (60 μg l−1, corresponding to 0.47 μM) than in estuaries (about 5 μg l−1, corresponding to 0.04 μM) or rivers (less than 0.2 μg l−1, corresponding to 1.6 nM in some Triassic mountain regions of northern Italy), and, consistent with this, freshwater trout contain 20 μg kg−1 of iodine compared to saltwater fishes (herring) with about 500–800 μg kg−1 (Venturi et al. 2000). The oceans are the largest reservoir of bioavailable iodine on the planet (Wong 1991) where total iodine levels are typically in the range of 0.5 μM (Truesdale et al. 1995a). From there, the element is transferred from the oceans to the atmosphere in the form of gas or aerosols and from there, by wind and rain, to land areas (Küpper et al. 2011; Truesdale et al. 1995b). Seaweeds contribute to this through a process called iodovolatilization which was discovered as early as the 1920s (Dangeard 1928; Kylin 1929). It has been proposed that iodide had the ancestral function of an ancient antioxidant in animals and that this resulted in the evolution of the thyroid gland (Venturi and Venturi 1999). Iodine plays a central role in thyroid physiology, being the essential element in thyroid hormones (THS) and the major constituent regulator of thyroid gland function (Thilly et al. 1992, reviewed by Küpper et al. 2011). Iodine from the diet is rapidly and efficiently absorbed (>90%) throughout the gastrointestinal tract (in particular, the duodenum; Yarrington and Pearce 2011). The kelp Laminaria digitata accumulates iodine to more than 30,000-times the concentration found in seawater, often representing an average content of 1% of dry weight and much higher levels in young thalli (Küpper et al. 1998). More recently, it was found that, in Laminaria, the accumulation of iodide serves the provision of a simple, inorganic antioxidant, which protects the thallus surface against reactive oxygen species (Küpper et al. 2008). If ozone is present, molecular iodine is released, which can undergo further photolytic and oxidative reactions with ozone yielding hygroscopic iodine oxides, resulting in aerosol particle formation, thus impacting coastal climate (Küpper et al. 2008). More recently, it was found that bromide complements iodide as antioxidant in Laminaria (Küpper et al. 2013). The world’s largest seaweed, the giant kelp Macrocystis pyrifera, shares key features of its halogen metabolism with Laminaria, even though the overall accumulation of iodine is lower (Tymon et al. 2017). Macrocystis forests were found to impact iodine speciation in surrounding seawater (Gonzales et al. 2017). In Laminaria, inorganic iodine emission rates exceed organic emissions (i.e. of halocarbons) by several orders of magnitude (Küpper et al. 2008; Palmer et al. 2005). Rates of halocarbon production vary considerably between species (Carpenter et al. 2000) and marine macroalgae are thought to be the dominant source of CH3I in the coastal ocean (Gschwend et al. 1985; Giese et al. 1999; Itoh 1997). Most studies exploring halocarbon emission by seaweeds were conducted on temperate and some polar seaweed species, while only a few have considered tropical species. Brown seaweeds from temperate regions including Laminariales and Fucales release large amounts of iodinated compounds (Carpenter et al. 2000, reviewed by Küpper et al. 2011; Küpper and Kroneck 2015). Much less is known about seaweeds from tropical regions. In this context, recent studies from Malaysia (Keng et al. 2020; Leedham et al. 2013) have investigated seaweeds, including Sargassum binderi, Padina australis, and Turbinaria conoides, which were dominant in a tropical coral reef, for their emissions of various volatile halocarbons.
Fluorine (F, atomic number 9, with an atomic weight of 18.9984 Da) is considered an essential element for animals including humans, which is primarily because of its benefits to dental health and its suggested role in maintaining the integrity of bones (Prystupa 2011), while continuing exposure to elevated levels are of concern. According to the World Health Organization (WHO), the recommended upper limit of fluoride in drinking water is between 0.8 and 1.5 mg l−1 (WHO 2019). The European Food Safety Authority (EFSA) recommends an intake of 0.05 mg of fluoride per kg of body weight per day for children and adults (EFSA Panel on Dietetic Products, Nutrition and Allergies 2013). Fluoride has been one of the most effective and widespread agents used to prevent dental caries (Petersen 2003). It is important to metabolism, formation and structure of bone and teeth, growth and reproduction and other physiological process in the human body (Liteplo et al. 2002). Fluoride species can be taken up by aquatic organisms directly from the water or, to a lesser extent, via food. Uptake depends on the anthropogenic sources, the local geology and the physicochemical conditions (Camargo 2003; Liteplo et al. 2002). Studies on the distribution of certain halogens in seaweeds show the equivalent concentrations of halogens in seaweeds are in the order I > F > Br > Cl, whereas in seawater the order of concentrations is Cl > Br > F > I (Rao and Indusekhar 1989). Little is known about the biological significance of fluorine in algae. Fluoride possibly increases the growth and metabolic activities of brown seaweeds (Camargo 2003). On the other hand, it was found that aluminofluoride and beryllofluoride, which are structural analogues of vanadate and phosphate, inhibited apo-(halo-)bromoperoxidase (a key enzyme in halogen metabolism of brown and red algae; Küpper and Kroneck 2015) from the North Atlantic brown alga Ascophyllum nodosum (Tromp et al. 1991). Haloperoxidases cannot catalyse fluorination reactions because hydrogen peroxide lacks the thermodynamic potential to oxidize fluoride; thus, enzymes catalysing fluorination reactions are not peroxidases (Butler and Sandy 2009). At present, it is not clear whether algae of any phylum contain fluorinating enzymes; in fact, the only fluorinase so far known to science is from the bacterium Streptomyces cattleya (O’Hagan et al. 2002). Also, it should be noted that among all marine organisms investigated so far, anywhere in the world, only one marine-derived Streptomyces xinghaiensis strain has been reported to produce a fluorinated metabolite, the structurally simple fluoroacetate (Huang et al. 2014; Ma et al. 2016). No fluorinated compounds have been reported from the entire breadth of algal diversity, including seaweeds. They are mainly producers of chlorinated, brominated and iodinated compounds due to the presence of vanadium haloperoxidases (e.g. Butler and Sandy 2009; Carter-Franklin and Butler 2004; Küpper et al. 2008; Küpper and Kroneck 2015). This may also be due to traditionally much less investigator effort focussing on algae in the natural products community compared to bacteria, fungi, sponges, etc. Considering that algae also harbour abundant and diverse bacterial communities, especially on their surfaces as biofilms, it would be surprising that there are no fluorinated compounds. Young and Langille (1958) found that fluoride content ranges from 3.02 to 18.86, 4.78 to 17.82 and 4.35–20.04 mg kg−1 dry weight in green, brown and red algae, respectively. Even though variations in fluoride content are observed in each class of algae, red algae, in general, tend to contain more fluoride compared to brown and green algae. Recently, there has been increasing interest in the potential of dried seaweed biomass for biosorption of fluoride from fluoride-contaminated water. In this context, it was found that dried Padina sp. (Phaeophyta) from the Red Sea (Mohamed et al. 2020) and Gracilaria sp. (Rhodophyta) from the Bay of Bengal (Babu et al. 2020) could be applied as eco-friendly biosorbents for fluoride.
The Arabian Gulf is a shallow basin that has been in existence, i.e. filled with sea water, for only around 15,000 years. Except at its entrance in the Straits of Hormuz, it is less than 60 m deep and it is located in one of the most arid regions of the world, characterized further by the greatest seasonal temperate range in the world as well as the highest annual sea temperature (Sheppard et al. 2010). The coastal environment of Kuwait (ca. 500 km coastline) can be divided into the Northern Region, Kuwait Bay, and the Southern Region. The Northern Region extends from the northern border of the state to Ras Al-Ardh. This area is influenced by outflows of freshwater from the Shatt Al-Arab waterway. The Southern Region extends from Ras Al-Salmiyah to the southern border of the state. Marine biota of the Gulf are mostly of Indo-Pacific affinity, however cold winds from the Anatolian and Iranian highlands limit the occurrence of more cold-sensitive taxa. For much of its area, the photic depth is 15 m or less. High evaporation (up to 2 m yr−1) results in salinities generally of at least 39, reaching 70 in the Gulf of Salwah off south-western Qatar. The Arabian Gulf is characterized by sandy seabeds and shores on its western side including the Qatar Peninsula with occasional limestone outcrops formed of fossilised reef rock, while genuine rocky shores occur mostly on the eastern (Iranian) shore. Indeed, organisms in the Gulf experience high levels of salinity as well as exceptional levels of temperature stress, which makes the region and its biota interesting models for studying the impacts of climate change (Sheppard et al. 2010). For almost all groups of biota, the Arabian Gulf has to be considered impoverished compared to the neighbouring Indian Ocean, which is due to both harsh environmental conditions and its young age as a sea area, while population densities of several groups of biota are similar to those of other tropical areas (Sheppard et al. 2010). For example, the Arabian Gulf harbours an impoverished subset of reef-building corals of the Indian Ocean (Sheppard 1998). However and despite a fairly general pattern of low diversity for most groups, more in-depth surveys have revealed a higher diversity than expected for some groups such as fish (Krupp et al. 2000; Price et al. 2002) and ocypodid crabs (Al-Khayat and Jones 1996). When the size of the water body was compensated for in a recent study of 2894 species of marine macroalgae from 66 sites in the Indian Ocean region, the Arabian Gulf overall ranked 62nd out of 66 in terms of algal diversity in all phyla/higher divisions, based on species richness, range rarity and average taxonomic distinctness (Price et al. 2006). Soft bottom substrata make up most of the surface of benthic habitats of the Arabian Gulf, yet rocky outcrops and coral reefs are common too and harbour significant biodiversity. Indeed, the largest high-diversity types of benthic environments in the Arabian Gulf are coral reefs and coral-dominated substrata, seagrass meadows and algal beds.
As the hottest and the most saline part of the world’s ocean, the Arabian Gulf is a unique environment. Yet, little is known about how organisms in the Arabian Gulf tolerate such extreme conditions and how this tolerance influences biodiversity. In this context, nothing at all is known about the accumulation and metabolism of halogens in seaweeds of the Arabian Gulf. This study was conducted in order to obtain a first insight into whether typical, common seaweeds of the Arabian Gulf, whose identification was underpinned by morphological and DNA barcoding, accumulate any iodine and fluorine at levels comparable to those in colder climates. Inductively coupled plasma-mass spectrometry (ICP-MS) and ion chromatography (IC) were employed as the key technique for this, since it provides excellent selectivity and sensitivity for the measurement of iodine (Oliveira et al. 2010; Pacquette et al. 2012; Picoloto et al. 2015; Schnetger and Muramatsu 1996; Sullivan and Zywicki 2012).
2 Materials and methods
2.1 Algal collections
Sampling locations were selected to represent a variety of geographical and ecological regions along the coastline of Kuwait (Table 1). Seaweed samples were collected during low tide (maximum tidal range is 3 m) from supratidal to subtidal zones of the intertidal regions of the selected locations. Although a few macroalgae were free-floating, most were found attached to stable substrata such as rocks, dead corals, pebbles, shells and seagrasses. Algal samples were rinsed thoroughly with seawater on-site and placed in plastic bags, transferred to the laboratory and were again washed three times with sea water. Subsequently, the fresh samples were frozen in a freezer for 24 h followed by drying in a freeze dryer (Labconco, USA) at −45 °C for 48 h and kept in the presence of silica gel to prevent re-moisturing.
Locations of sampling sites in Kuwait during the surveys and collections in May and June 2018 and February 2019, respectively.
| Date | Location | Coordinates | Offshore seawater surface temper-ature (ᵒC) |
|---|---|---|---|
| 27/05/2018 | Salwa Enjefa Beach | 29°17′52.4″N 48°05′18.6″E | 28.20–28.35 |
| 26/05/2018 | Bnaider Beach | 28°47′01.5″N 48°17′50.6″E | 27.75–27.90 |
| 27/05/2018, 2/06/2018, 3/06/2018 | Abu Al Hasaniya | 29°12′19.4″N 48°06′41.5″E | 30.15–30.30 |
| 2/6/2018 | Nuwaiseeb | 28°34′35.8″N 48°24′04.0″E | 31.20–31.35 |
| 6/02/2019 | Khiran | 28°39′22.8″N 48°23′33.4″E | 16.50–16.65 |
| 6/02/2019 | Lagoon of Khiran resort | 28°39′47.2″N 48°22′11.7″E | 16.50–16.65 |
2.2 Determination of total iodine concentrations in tissue samples
Iodine was extracted from algal tissues by alkaline leaching with tetramethylammonium hydroxide (TMAH; Sigma Aldrich, USA) and the total iodine concentration was subsequently determined by ICP-MS. Replicate field-collected samples of blade, holdfast and stipe of a given species were lyophilized and ground to a fine powder using a mortar and pestle. Approximately 0.1 g of the powdered algal material was incubated with 2 mL of 25% TMAH for approximately 72 h at room temperature. The sample was centrifuged and the supernatant was decanted and diluted to approximately 0.25% TMAH. For the determination of the total element content an Agilent 8800 Triple Quadrupole ICP-MS (Agilent Technologies, UK) equipped with a Scott-type spray chamber and a MicroMist concentric glass nebulizer (Glass Expansion, West Melbourne, Australia) was used. The sample and skimmer cones were composed of Ni. The ICP-MS/MS was operated in oxygen (MS/MS-mode) mode for different elements. Collision/reaction cell (CRC) gas flow rates for oxygen were 30% (∼ 0.3 mL min−1). Instrument calibration was performed by employing iodine standards of up to 1000 ng mL−1 in dilute TMAH. Duplicate trials were averaged.
2.3 Determination of total fluoride concentrations in tissue samples by ion chromatography (IC)
The dried seaweed (obtained from 4.5 - 11 kg fresh weight) was ground to power with an electric grinder mixture. The powder sample of each species was macerated in water at room temperature. After the filtration, water was evaporated under vacuum using a rotary evaporator down to a final volume of 1 ml (which was adjusted by adding water if appropriate). The obtained crude extracts were then kept in a cold room at 4 °C. After that, 100 µL from each species were diluted to 30,000 µL to fit in the calibration working range. Fluoride concentrations in the seaweed were analysed using a Metrohm IC 882 (Herisau, Switzerland) with conductivity detector, a Metrohm A Supp (150 × 4.0 mm) chromatographic column and metrosep RP guard 3.5. The eluent was 3.2 mM sodium carbonate and 0.1 mM sodium bicarbonate with flow rate of 0.7 m min−1; run time was 7 min with a 20 μL injection volume. Calibration was carried out using 1, 5, 10, and 20 mg L−1 fluoride, prepared from 1000 mg L−1 fluoride standard stock solution.
2.4 Morphological and molecular identification of seaweed taxa
For each taxon collected, a herbarium voucher specimen was prepared on Bristol paper with a subsample being kept both in silica gel and CTAB for subsequent DNA extraction. Herbarium specimens were deposited in the Kuwait University Herbarium (KTUH).
2.5 DNA extraction
About 20 mg of silica gel-dried or CTAB-stored algal material were ground using a mortar and pestle or QIAGEN Tissue Lyser II (Hilden, Germany) at 30 Hz for 10 min, followed by total DNA extraction using the GenElute™ Plant Genomic DNA Miniprep Kit (Sigma, Aldrich) according to the manufacturer’s instructions.
2.6 DNA amplification and sequencing
The extracted DNA was amplified by PCR using 11 primers pairs (Table 2). PCR master mix was prepared using a Taq PCR Kit (Qiagen, Hilden, Germany). Samples were subjected to the PCR programs detailed in Table 3.
Primer pairs and PCR conditions used in this study.
| Locus | Marker | Primer | Length of amplified target (bp) | Position | Direction | Sequence 5′-3′ | PCR parameters | Reference |
|---|---|---|---|---|---|---|---|---|
| Nuclear | nrSSU | NS1F NS4R | 1100 | 35 1108 | F R | GTAGTCATATGCTTGTCTC CTTCCGTCAATTCCTTTAAG | 4 min at 94 °C, followed by 35 cycles of 1 min at 94 °C, 30 s at 62 °C, and 1 min at 72 °C, and finally an elongation step of 5 min at 72 °C. | White et al. 1990 |
| ITS2 | ITS KP5 ITS KG4 | NA | F R | ACAACGATGAAGAACGCAG CTTTTCCTCCGCTTAGTTATATG | 3 min at 94 °C, followed by 35 cycles of 1 min at 94 °C, 30 s at 50 °C, and 1 min at 72 °C, and finally an elongation step of 7 min at 72 °C. | Lane et al. 2006 | ||
| Chloroplast | psaA | psaA 870F psaA1760R | 890 | 870 1760 | F R | GGNGGWYTATGGTTAAGTGA CCTCTWCCWGGWCCATCRCAWGG | 94 °C for 5 min, 37 cycles of 94 °C for 1 min s, 45 °C for 1 min and 72 °C for 1 min and a final elongation step of 5 min at 72 °C. | Yoon et al. 2002 |
| psaA | PsaA130 psaA 970 | 840 | 130 970 | F R | AACWACWACTTGGATTTGGAA GCYTCTARAATYTCTTTCA | 94 °C for 5 min, 37 cycles of 94 °C for 1 min, 45 °C for 1 min and 72 °C for 1 minand a final elongation step of 5 min at 72 °C | Yoon et al. 2002 | |
| Mitochondrial | COI-3P | COI-789F COI-1378R | 589 | 789 1378 | F R | TNTAYCARCATTTATTTTGGTT TCYGGNATACGNCGNGGATACC | 5 min at 94 °C, followed by 25 cycles of 30 s at 94 °C, 30 s at 46 °C, and 40 s at 72 °C, and finally an elongation step of 5 min at 72 °C | Silberfeld et al. 2010 |
| COI-5P | GazF2 GazR2 | 657 | 104 803 | F R | CCAACCAYAAAGATATWGGTAC GGATGACCAAARAACCAAA | 2 min at 94 °C, followed by 35 cycles of 30 s at 94 °C, 30 s at 50 °C, and 1 min at 72 °C, and finally an elongation step of 5 min at 72 °C | Saunders 2005, Lane et al. 2007 |
NA: not applicable.
Identity of seaweed species, DNA sequences obtained, and iodine and fluorine levels observed in them within the framework of this study.
| Species | Phylogenetic affinity | Herbarium code | Date and site collected | Identification based upon /locus sequenced | Iodine concentration | Fluorine concentration | ||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| (μg g−1 DW = ppm) | (μg g−1 FW) | (mol g−1 DW) | (mol g−1 FW) | (μg g−1 DW = ppm) | (μg g−1 FW) | (mol g−1 DW) | (mol g−1 FW) | |||||
| Chondria sp. C. Agardh | Ceramiales, Florideophyceae, Rhodophyta | BNA260518-1 | 26/05/2018 Bnaider Beach | COI | 129.04 | 5.80 | 1.016E-3 | 4.571E-5 | 2.84 ± 0.00002 | 0.13 ± 0.0000009 | 1.495E-4 ± 1.05272E-09 | 6.719E-6 ± 4.73E-11 |
| Codium papillatum C.K.Tseng et W.J.Gilbert | Bryopsidales, Ulvophyceae, Chlorophyta | ABUH030618-2 | 03/06/2018 Abu Al Hasaniya | – | 49.59 | 1.45 | 3.907E-4 | 1.141E-5 | 72.32 ± 0.0051 | 2.11 ± 0.00015 | 3.807E-3 ± 2.69E-07 | 1.111E-4 ± 7.85E-09 |
| Colpomenia sinuosa (Mertens ex Roth) Derbès et Solier | Ectocarpales, Phaeophyceae, Ochrophyta | ANJ270518-1 | 27/05/2018 Salwa Enjefa Beach | psaA | 66.19 | 1.02 | 5.216E-4 | 8.033E-6 | 7.84 ± 0.000001 | 0.12 ± 0.0000000 | 4.127E-4 ± 5.26E-11 | 6.355E-6 ± 8.11E-13 |
| Dictyotadichotoma (Hudson) J.V. Lamouroux | Dictyotales, Phaeophyceae, Ochrophyta | NUW020618-1 | 02/06/2018 Nuwaiseeb | nrSSU | 85.47 | 2.76 | 6.736E-4 | 2.173E-5 | 2.07 ± 0.00007 | 0.07 ± 0.0000023 | 1.090E-4 ± 3.68E-09 | 3.515E-6 ± 1.19E-10 |
| Iyengaria stellata (Børgesen) Børgesen | Ectocarpales, Phaeophyceae, Ochrophyta | ABUH060618-1 | 27/05/2018 Abu Al Hasaniya | psaA | 44.55 | 3.92 | 3.510E-4 | 3.094E-5 | 12.19 ± 0.00005 | 1.07 ± 0.0000044 | 6.416E-4 ± 2.63E-09 | 5.654E-5 ± 2.32E-10 |
| Padina boergesenii Allender et Kraft | Dictyotales, Phaeophyceae, Ochrophyta | ABUH270518-1 | 27/05/2018Abu Al Hasaniya | psaA | 52.54 | 2.40 | 4.141E-4 | 1.8902E-5 | 2.6 ± 0.00002 | 0.12 ± 0.0000009 | 1.369E-4 ± 1.05E-09 | 6.246E-6 ± 4.80E-11 |
| Feldmannia indica (Sonder) Womersley et A.Bailey | Ectocarpales, Phaeophyceae, Ochrophyta | ABUH030618-1 | 03/06/2018 Abu Al Hasaniya | – | 229.42 | 11.87 | 1.8081E-3 | 9.357E-5 | 2.66 ± 0.00001 | 0.14 ± 0.0000005 | 1.400E-4 ± 5.26E-10 | 7.246E-6 ± 2.72E-11 |
| Sargassum ilicifolium var. acaraeocarpum Grunow | Fucales, Phaeophyceae, Ochrophyta | ABUH270518-3 | 26/05/2018 Bnaider Beach | ITS2 | 177.55 | 19.95 | 1.399E-3 | 1.572E-4 | 4.63 ± 0.00001 | 0.52 ± 0.0000011 | 2.437E-4 ± 5.26E-10 | 2.738E-5 ± 5.91E-11 |
| Sargassum ilicifolium (Turner) C.Agardh | Fucales, Phaeophyceae, Ochrophyta | KHI060219-1 | 06/02/2019 Khiran | COI | 187.14 | 31.49 | 1.475E-3 | 2.482E-4 | 0.2 ± 0.000006 | 0.015 ± 0.0000005 | 2E-1 ± 3.16E-10 | 1.515E-2 ± 2.39E-11 |
| Sargassum asperifolium Hering et G.Martens ex J.Agardh | Fucales, Phaeophyceae, Ochrophyta | ABUH270518-4 | 26/05/2018 Bnaider Beach | – | 614.61 | 30.21 | 4.843E-3 | 2.380E-4 | 0.17 ± 0.000004 | 0.008 ± 0.0000002 | 8.948E-6 ± 2.11E-10 | 4.398E-7 ± 1.03E-11 |
| Sargassum aquifolium (Turner) C.Agardh | Fucales, Phaeophyceae, Ochrophyta | ABUH270518-2 | 27/05/2018 Abu Al Hasaniya | COI-3P | 925.10 | 123.85 | 7.290E-3 | 9.759E-4 | 17.75 ± 0.00008 | 2.376 ± 0.0000107 | 9.343E-4 ± 4.21E-09 | 1.251E-4 ± `5.63E-10 |
PCR products were examined on 0.7% (w/v) agarose gel (Bio-Rad Laboratories, USA) to confirm length and concentration of the PCR products. PCR products were purified using the QIAquick PCR purification kit (QIAGEN, Maryland, USA) and were fluorescently labeled using Big-dye V-3.1 reagent mix (Applied Biosystems/ABI, USA) following manufacturers’ protocols. Products were then purified using sodium acetate and ethanol before being sequenced using a 3130 × 1 Genetic Analyzer (Applied Biosystems/ABI, USA). Some were purified and adjusted to the required concentration and sent away for commercial Sanger sequencing (Source Bioscience, UK). Obtained sequences were initially analyzed by comparative methods on established public-domain databases using the BLAST (Basic Local Alignment Search Tools) algorithm (http://www.ncbi.nih.gov) (Altschul et al. 1997). The BioEdit (http://www.mbio.ncsu.edu/ BioEdit/bioedit.html) program was used for sequence alignment of the forward and reverse sequence. The resulting alignment was corrected manually. The sequence was analyzed again by BLAST for sequence similarities in order to support identification of the seaweed taxa. The sequences were deposited in GenBank (Table 4).
List of seaweeds used in this study with markers used for molecular identification, closest sequence match and accession numbers.
| Morphological identification | Locus | Markers | Primer | Closest match | Query cover | Identity | Accession no. of closest match | Genbank accession no. |
|---|---|---|---|---|---|---|---|---|
| Feldmannia indica | Identification based on morphology | |||||||
| Padina boergesenii | Chloroplast | psaA | psaA870F psaA1760R | Padina boergesenii | 100% | 100% | JQ364159.1 | MT683780 |
| Iyengaria stellata | Chloroplast | psaA | PsaA 130F psaA 970R | Iyengaria stellata | 96% | 100% | MN587733.1 | MT683777 |
| Dictyota dichotoma | Nuclear | nrSSU | AFP2F AFP1R | Dictyota dichotoma | 97% | 99.8% | AF130702.1 | MT657272 |
| Colpomenia sinuosa | Chloroplast | psaA | PsaA 130F psaA 970R | Colpomenia sinuosa | 98% | 99.84% | MN587728.1 | MT683778 |
| Sargassum aquifolium | Mitochondrium | COI-3P | cox1-789F cox1-1378R | Sargassum aquifolium | 100% | 99.17% | KT266809.1 | MT783839 |
| Sargassum asperifolium | Identification based on morphology | |||||||
| Sargassum ilicifolium var. acaraeocarpum | Nuclear | ITS2 | ITS KP5 ITS KG4 | Sargassum ilicifolium var. acaraeocarpum | 76% | 100% | KP720362.1 | MT664751 |
| Sargassum ilicifolium | Mitochondrium | COI-5P | cox1-GazF2 cox1-GazR2 | Sargassum ilicifolium | 88% | 99.03% | MG893221.1 | MT783840 |
| Codium papillatum | Identification based on morphology | |||||||
| Chondria sp. | Mitochondria | COI-5P | cox1-GazF2 cox1-GazR2 | Chondria cf. curdieana | 95.86% | 95.5% | MG843862.1 | MT683781 |
3 Results
Iodine was detectable in all seaweed samples collected from Kuwait, with concentrations ranging from 49.59 μg g−1 DW in Codium papillatum, 129.04 μg g−1 DW in Chondria sp. and 925.10 μg g−1 DW in Sargassum asperifolium (Table 4). Likewise, fluoride levels ranged from 0.20 μg g−1 DW in Sargassum aquifolium to 72.32 μg g−1 DW in C. papillatum (Table 3).
Species identification of seaweeds used in this study was based on morphological criteria supported by DNA sequencing and molecular phylogenetics. From a total of 11 seaweed samples, eight sequences were obtained (Tables 3 and 4) which could clearly be recognized as one red, one green, and seven brown algae. Using DNA sequences of different markers the following taxa were identified: Padina boergesenii (psaA); Iyengaria stellata (psaA), Dictyota dichotoma (nrSSU), Colpomenia sinuosa (psaA), S. aquifolium (COI-3P), S. ilicifolium var. acaraeocarpum (ITS2), S. ilicifolium (COI-5P) and Chondria sp. (COI-5P). Codium papillatum, Feldmannia indica and S. asperifolium were identified based on morphological criteria, since no useable sequences could be obtained.
4 Discussion
The results presented here constitute the first report of iodine and fluorine concentrations in seaweeds of the Arabian Gulf – and are among the first for warm-temperate and tropical seaweeds. The iodine levels observed in this study are in a range comparable to those reported from the same genera elsewhere (Ar Gall et al. 2004; Küpper et al. 1998; Saenko et al. 1978). Given the established role of iodide in controlling oxidative stress on seaweed surfaces (Küpper et al. 2008) and also given the reduced iodine levels observed in the North Atlantic kelp L. digitata during the summer, likely due to high irradiance and high temperatures (Ar Gall et al. 2004), it would be of interest to conduct a seasonal survey of iodine levels in the species which were found to contain the highest iodine levels – in particular S. aquifolium, S. asperifolium and S. ilicifolium var. acaraeocarpum. It should be noted that most samples used in the present study were collected during the cold season, when seawater temperatures are 15–20 °C lower than during the summer (Al-Yamani, 2004). Overall, there is a tendency that the brown algae surveyed here have higher iodine levels than the red and especially than the green algae – which is a pattern also reported from another part of the world (Saenko et al. 1978).
Halogens, such as iodine and bromine and their respective organohalides, shape major atmospheric processes mainly through destruction of toxic surface ozone and provision of condensation nuclei for cloud formation (Küpper et al. 2008; Palmer et al. 2005). Seaweed-derived atmospheric iodine emissions also have a high significance for human and animal health by supplying the essential element for thyroid functioning (Küpper et al. 2011). Seaweeds have been identified as major emitters of these elements to the coastal atmosphere in different parts of the world, especially the cold-temperate North Atlantic (Küpper et al. 2011). Most of this knowledge is based on studying the native North Atlantic model seaweed, L. digitata, thus constituting a strong sampling bias with regard to species diversity and the geographic extent of this phenomenon. The potential contribution of dominant seaweed species to halogen production along continental coasts in warm-temperate and tropical climates, particularly along the Arabian Gulf, is virtually unknown. Because the Gulf region experiences some of the highest ground-level ozone concentrations in the world (Lelieveld et al. 2009), examining the contribution of region-specific seaweed species to halogen production has direct implications for the understanding of atmospheric/climatic processes and the public health of the region. Gaseous emissions from iodine metabolism in seaweeds have both an atmospheric impact (depleting surface ozone and acting as condensation nuclei for cloud formation) and contribute to the supply of thyroid iodine in the coastal population (Küpper et al. 2011). In this context, a better understanding of the extent to which the region’s seaweeds potentially constitute a natural scavenger for harmful ground-level ozone, and contribute to cloud formation and to human thyroid iodine supply, would be desirable.
Also, fluoride was present in similar, significant concentrations comparable to those found for iodine. Given how little is known about fluorine accumulation in seaweeds, this constitutes a particular novelty of the present study in general – not limited to the Arabian Gulf. Interestingly, while Codium sp. showed among the lowest iodine levels here, the same sample contained the highest fluorine levels – and vice versa for Sargassum species, which were among the strongest accumulators of iodine but among the weakest for fluorine. This deserves further investigation, but at present, one can only speculate about the underlying reasons. Very little is known about the regulation and homoeostasis of halogen accumulation in seaweeds in general. Ar Gall et al. (2004) found iodine levels in the kelp L. digitata to be around half of their winter levels during summer, while a competitive inhibition of bromide accumulation by increased, exogenous iodide levels (which may be somewhat reminiscent of the results of the present study) was observed in the filamentous brown alga Ectocarpus (Küpper et al. 2018). However, given the very different physico-chemical properties of iodide and fluoride, it seems unlikely that the same transport and storage mechanisms are operative for both. In particular, while iodine and bromine uptake in marine algae is usually driven by V haloperoxidases (Küpper et al. 2011; Küpper et al. 2013; Küpper and Kroneck 2015), this class of enzymes cannot mediate fluoride uptake since hydrogen peroxide cannot oxidize fluoride (Butler and Sandy 2009); thus, another, likely totally different pathway must be at play for fluoride accumulation.
Significantly, the findings of S. ilicifolium and S. ilicifolium var. acaraeocarpum reported here are new records both for Kuwait and the Arabian Gulf, while P. boergesenii and D. dichotoma are new records for Kuwait. C. papillatum, P. boergesenii, D. dichotoma, S. asperifolium and S. aquifolium have previously been reported from the Arabian Gulf (John and Al-Thani 2014). Likewise, I. stellata and C. sinuosa are known specifically from Kuwait (Al-Yamani et al. 2014; Silva et al. 1996). It is worth noting that the DNA sequences reported here are the first for any seaweeds from the entire Arabian Gulf, highlighting also how understudied the region is with regards to molecular algal taxonomy. However, this also highlights a general challenge when working in this region – a robust identification of the taxa investigated in this study will only be possible when a larger dataset is available. Thus, the situation is even more complicated than e.g. in the Mediterranean where a recent review highlighted the need for obtaining DNA barcode sequences for a much larger breadth of taxa (Bartolo et al. 2020).
Funding source: Kuwait Institute for Scientific Research
Award Identifier / Grant number: PhD funding for Hanan Al-Adilah
About the authors
Hanan Al-Adilah (right) is a research associate at Kuwait Institute for Scientific Research. She has a BSc in plant biology from Kuwait University (2011). She obtained her Master’s degree from Kuwait University with distinction, in the field of marine phytoplankton diversity in 2015. She is currently in the 4th year of her PhD in algal diversity and biochemistry at the University of Aberdeen aiming at exploring the halogen metabolism of seaweeds of the Arabian Gulf.
Akira F. Peters is a gentleman scientist. Since the beginning of his scientific career in 1980 he has worked on life histories, taxonomy, phylogenetics, ecology, pathology, genetics, development, cultivation and utilisation of brown algae. He has a PhD from Konstanz University, Germany, is director of the enterprise Bezhin Rosko (www.bezhinrosko.com) and lives near Roscoff in Brittany, NW France. His main techniques are isolation, purification and laboratory cultivation of seaweed microstages.
Dhia Al-Bader is an associate professor at Botany Program, Department of Biological Sciences, Kuwait University. Research in her lab includes the use of environmental DNA to resolve algal biodiversity, study of algal phylogeny and stress tolerance of seagrasses and algae.
Joerg Feldmann is an expert in environmental analytical chemistry with an emphasis on elemental speciation. He was the director of TESLA at University of Aberdeen for 23 years before he moved to University of Graz, Austria in 2020. He has published more than 250 papers (h-index 67) and received numerous prizes since as the 2015 European Award for Plasma Spectrochemistry and 2016 RSC Interdisciplinary Prize and Medal and he was elected as a fellow of the Royal Society of Edinburgh.
Frithjof C. Küpper (left) has held the chair in marine biodiversity at the University of Aberdeen since 2011. Over the past 30 years, he has studied the biodiversity and biochemistry of marine plants/algae. He conducted graduate studies at Roscoff and Konstanz for a joint French-German Ph.D. His research resulted in the finding of iodide serving as an inorganic antioxidant in kelp, the first described from a living system, impacting atmospheric and marine chemistry. A certified scientific diver, Frithjof has worked extensively in the Mediterranean, South Atlantic (Ascension and Falkland Islands), Antarctica, the Arctic and the Arabian Gulf for algal diversity-related projects.
Acknowledgments
We are thankful to the sequencing facility in Kuwait University (Project # GS01/02) and Department of Marine Sciences for using their facilities and labs.
Author contribution: All the authors have accepted responsibility for the entire content of this submitted manuscript and approved submission.
Research funding: We are grateful to the Kuwait Institute for Scientific Research (KISR) for PhD funding for Hanan Al-Adilah. We would equally like to thank the UK Natural Environment Research Council for their support to FCK (program Oceans 2025 – WP 4.5 and grants NE/D521522/1 and NE/J023094/1). This work also received support from the Marine Alliance for Science and Technology for Scotland pooling initiative. MASTS is funded by the Scottish Funding Council (grant reference HR09011) and contributing institutions.
Conflict of interest statement: The authors declare no conflicts of interest regarding this article.
References
Al-Khayat, J.A. and Jones, D.A. (1996). Two new genera, Manningis and Leptochryseus (Decapoda: Camptandriinae), and descriptions of the first zoea of six brachyurans from the Arabian Gulf. J. Crustac Biol. 16: 797–813, https://doi.org/10.1163/193724096X00856.Search in Google Scholar
Al-Yamani, F., Polikarpov, I., Al-Ghunaim, A., and Mikhaylova, T. (2014). Field guide of marine macroalgae (Chlorophyta, Rhodophyta, Phaeophyceae) of Kuwait. Kuwait: Kuwait Institute for Scientific Research, pp. 190.Search in Google Scholar
Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J.H., Zhang, Z., Miller, W., and Lipman, D.J. (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25: 3389–3402, https://doi.org/10.1093/nar/25.17.3389.Search in Google Scholar
Ar Gall, E., Küpper, F.C., and Kloareg, B. (2004). A survey of iodine contents in Laminaria digitata. Bot. Mar. 47: 30–37, https://doi.org/10.1515/BOT.2004.004.Search in Google Scholar
Babu, A.N., Reddy, D.S., Kumar, G.S., Ravindhranath, K., and Mohan, G.V.K. (2020). Sequential synergetic sorption analysis of Gracilaria (Rhodophyta) biochar toward aluminum and fluoride: a statistical optimization approach. Water Environ. Res. 92: 880–898, https://doi.org/10.1002/wer.1283.Search in Google Scholar
Bartolo, A., Zammit, G., Peters, A.F., and Küpper, F.C. (2020). DNA barcoding of macroalgae in the Mediterranean Sea. Bot. Mar., 63: 253–272, https://doi.org/10.1515/bot-2019-0041.Search in Google Scholar
Butler, A. and Sandy, M. (2009). Mechanistic considerations of halogenating enzymes. Nature 460: 848–854, https://doi.org/10.1038/nature08303.Search in Google Scholar
Camargo, J.A. (2003). Fluoride toxicity to aquatic organisms: a review. Chemosphere 50: 251–264, https://doi.org/10.1016/s0045-6535(02)00498-8.Search in Google Scholar
Carpenter, L.J., Malin, G., Küpper, F.C., and Liss, P.S. (2000). Novel biogenic iodine-containing trihalomethanes and other short-lived halocarbons in the coastal East Atlantic. Global Biogeochem. Cycles 14: 1191–1204, https://doi.org/10.1029/2000gb001257.Search in Google Scholar
Carter-Franklin, J.N. and Butler, A. (2004). Vanadium bromoperoxidase-catalyzed biosynthesis of halogenated marine natural products. J. Am. Chem. Soc. 126: 15060–15066, https://doi.org/10.1021/ja047925p.Search in Google Scholar
Dangeard, P. (1928). Sur le dégagement de l’iode chez les algues marines. Comptes Rendus Hebd. Seances Acad. Sci. 186: 892–894.Search in Google Scholar
EFSA Panel on Dietetic Products, Nutrition, and Allergies. (2013). Scientific opinion on dietary reference values for fluoride. EFSA. J. 11: 3332, https://doi.org/10.2903/j.efsa.2013.3332.Search in Google Scholar
Giese, B., Laturnus, F., Adams, F.C., and Wiencke, C. (1999). Release of volatile iodinated C1− C4 hydrocarbons by marine macroalgae from various climate zones. Environ. Sci. Technol. 33: 2432–2439, https://doi.org/10.1021/es980731n.Search in Google Scholar
Gonzales, J., Tymon, T., Küpper, F.C., Edwards, M.S., and Carrano, C.J. (2017). The potential role of kelp forests on iodine speciation in coastal seawater. PloS One 12: e0180755, https://doi.org/10.1371/journal.pone.0180755.Search in Google Scholar
Gschwend, P.M., MacFarlane, J.K., and Newman, K.A. (1985). Volatile halogenated organic compounds released to seawater from temperate marine macroalgae. Science 227: 1033–1035, https://doi.org/10.1126/science.227.4690.1033.Search in Google Scholar
Huang, S., Ma, L., Tong, M.H., Yu, Y., O’Hagan, D., and Deng, H. (2014). Fluoroacetate biosynthesis from the marine-derived bacterium Streptomyces xinghaiensis NRRL B-24674. Org. Biomol. Chem. 12: 4828–4831, https://doi.org/10.1039/c4ob00970c.Search in Google Scholar
Itoh, N. (1997). Volatile halogenated compounds from marine algae; Their formation mechanisms and geochemical aspects. Recent Res. Devel. Phytochem. 1: 309–327.Search in Google Scholar
John, D.M. and Al-Thani, R.F. (2014). Benthic marine algae of the Arabian Gulf: a critical review and analysis of distribution and diversity patterns. Nova Hedwigia 98: 341–392, https://doi.org/10.1127/0029-5035/2014/0156.Search in Google Scholar
Keng, F.S.L., Phang, S.M., Abd Rahman, N., Elvidge, E.C.L., Malin, G., and Sturges, W.T. (2020). The emission of volatile halocarbons by seaweeds and their response towards environmental changes. J. Appl. Phycol. 32: 1377–1394, https://doi.org/10.1007/s10811-019-02026-x.Search in Google Scholar
Krupp, F., Almarri, M., Zajonz, U., Carpenter, K., Almatar, S., and Zetzsche, H. (2000). Twelve new records of fishes from the Gulf. Fauna of Arabia 18: 323–335.Search in Google Scholar
Küpper, F.C., Schweigert, N., Ar Gall, E., Legendre, J.M., Vilter, H., and Kloareg, B. (1998). Iodine uptake in Laminariales involves extracellular, haloperoxidase-mediated oxidation of iodide. Planta 207: 163–171, https://doi.org/10.1007/s004250050469.Search in Google Scholar
Küpper, F.C., Carpenter, L.J., McFiggans, G.B., Palmer, C.J., Waite, T.J., Boneberg, E.M., and Feiters, M.C. (2008). Iodide accumulation provides kelp with an inorganic antioxidant impacting atmospheric chemistry. In: Proceedings of the National Academy of Sciences of the United States of America, 105, pp. 6954–6958, https://doi.org/10.1073/pnas.0709959105.Search in Google Scholar
Küpper, F.C., Feiters, M.C., Olofsson, B., Kaiho, T., Yanagida, S., Zimmermann, M.B., and Kloo, L. (2011). Commemorating two centuries of iodine research: an interdisciplinary overview of current research. Angew. Chem. Int. Ed. 50: 11598–11620, https://doi.org/10.1002/anie.201100028.Search in Google Scholar
Küpper, F.C., Carpenter, L.J., Leblanc, C., Toyama, C., Uchida, Y., Verhaeghe, E., and Feiters, M.C. (2013). Speciation studies and antioxidant properties of bromine in Laminaria digitata reinforce the significance of iodine accumulation for kelps. J. Exp. Bot. 64: 2653–2664, https://doi.org/10.1093/jxb/ert110.Search in Google Scholar
Küpper, F.C. and Kroneck, P.M.H. (2015). Iodine bioinorganic chemistry: physiology, structures, and mechanisms. In: Kaiho, T. (Ed.), Iodine chemistry and applications. Hoboken: John Wiley & Sons, pp. 557–589.10.1002/9781118909911.ch32Search in Google Scholar
Küpper, F.C., Miller, E.P., Andrews, S.J., Hughes, C., Carpenter, L.J., Meyer-Klaucke, W., and Carrano, C.J. (2018). Emission of volatile halogenated compounds, speciation and localization of bromine and iodine in the brown algal genome model Ectocarpus siliculosus. J. Biol. Inorg. Chem., 23 1119–1128, https://doi.org/10.1007/s00775-018-1539-7.Search in Google Scholar
Kylin, H. (1929). Über das Vorkommen von Jodiden, Bromiden und Jodidoxydasen bei Meeresalgen. Hoppe-Seyler’s Z. für Physiol. Chem. 186: 50–84.10.1515/bchm2.1930.186.1-2.50Search in Google Scholar
Lane, C.E., Mayes, C., Druehl, L.D., and Saunders, G.W. (2006). A multi-gene molecular investigation of the kelp (Laminariales, Phaeophyceae) supports substantial taxonomic re-organization (Vol 42, pg 493, 2006). J. Phycol. 42: 962, 962, https://doi.org/10.1111/j.1529-8817.2006.00253.x.Search in Google Scholar
Lane, C.E., Lindstrom, S.C., and Saunders, G.W. (2007). A molecular assessment of northeast Pacific Alaria species (Laminariales, Phaeophyceae) with reference to the utility of DNA barcoding. Mol. Phylogenet. Evol. 44: 634–648, https://doi.org/10.1016/j.ympev.2007.03.016.Search in Google Scholar
Leedham, E.C., Hughes, C., Keng, F.S.L., Phang, S.M., Malin, G., and Sturges, W.T. (2013). Emission of atmospherically significant halocarbons by naturally occurring and farmed tropical macroalgae. Biogeosciences 10: 3615–3633, https://doi.org/10.5194/bg-10-3615-2013.Search in Google Scholar
Lelieveld, J., Hoor, P., Jockel, P., Pozzer, A., Hadjinicolaou, P., Cammas, J.P., and Beirle, S. (2009). Severe ozone air pollution in the Persian Gulf region. Atmos. Chem. Phys. 9: 1393–1406, https://doi.org/10.5194/acp-9-1393-2009.Search in Google Scholar
Liteplo, R., Beauchamp, R., Meek, M., and Chenier, R. (2002). Formaldehyde (Concise International Chemical Assessment Documents). Geneva: World Health Organization.Search in Google Scholar
Ma, L., Li, Y.F., Meng, L.P., Deng, H., Li, Y.Y., Zhang, Q., and Diao, A.P. (2016). Biological fluorination from the sea: discovery of a SAM-dependent nucleophilic fluorinating enzyme from the marine-derived bacterium Streptomyces xinghaiensis NRRL B24674. RSC Adv. 6: 27047–27051, https://doi.org/10.1039/c6ra00100a.Search in Google Scholar
Mohamed, W.S.E., Hamad, M., and Kamel, M.Z. (2020). Application of statistical response surface methodology for optimization of fluoride removal efficiency by Padina sp. alga. Water Environ. Res. 92: 1080–1088, https://doi.org/10.1002/wer.1305.Search in Google Scholar
O’Hagan, D., Schaffrath, C., Cobb, S.L., Hamilton, J.T.G., and Murphy, C.D. (2002). Biosynthesis of an organofluorine molecule – a fluorinase enzyme has been discovered that catalyses carbon-fluorine bond formation. Nature 416: 279, 279, https://doi.org/10.1038/416279a.Search in Google Scholar
Oliveira, A.A., Trevizan, L.C., and Nobrega, J.A. (2010). Iodine determination by inductively coupled plasma spectrometry. Appl. Spectrosc. Rev. 45: 447–473, https://doi.org/10.1080/05704928.2010.502207.Search in Google Scholar
Pacquette, L.H., Levenson, A.M., and Thompson, J.J. (2012). Determination of total iodine in infant formula and nutritional products by inductively coupled plasma/mass spectrometry: single-laboratory validation. J. AOAC Int. 95: 169–176, https://doi.org/10.5740/jaoacint.10-472.Search in Google Scholar
Palmer, C.J., Anders, T.L., Carpenter, L.J., Küpper, F.C., and McFiggans, G.B. (2005). Iodine and halocarbon response of Laminaria digitata to oxidative stress and links to atmospheric new particle production. Environ. Chem. 2: 282–290, https://doi.org/10.1071/en05078.Search in Google Scholar
Petersen, P.E. (2003). The world oral health report 2003: continuous improvement of oral health in the 21st century–the approach of the WHO global oral health programme. Community Dent. Oral Epidemiol. 31: 3–24, https://doi.org/10.1046/j.2003.com122.x.Search in Google Scholar
Picoloto, R.S., Doneda, M., Flores, E.L., Mesko, M.F., Flores, E.M., and Mello, P.A. (2015). Simultaneous determination of bromine and iodine in milk powder for adult and infant nutrition by plasma based techniques after digestion using microwave-induced combustion. Spectrochim. Acta B Atom Spectrosc. 107: 86–92, https://doi.org/10.1016/j.sab.2015.02.007.Search in Google Scholar
Price, A.R.G., Jones, D.A., and Krupp, F. (2002). Biodiversity: Backhuys Publishers, pp. 105–123.10.14321/j.ctt1tm7jkg.13Search in Google Scholar
Price, A.R.G., Vincent, L.P.A., Venkatachalam, A.J., Bolton, J.J., and Basson, P.W. (2006). Concordance between different measures of biodiversity in Indian Ocean macroalgae. Mar. Ecol. Prog. Ser. 319: 85–91, https://doi.org/10.3354/meps319085.Search in Google Scholar
Prystupa, J. (2011). Fluorine-A current literature review. An NRC and ATSDR based review of safety standards for exposure to fluorine and fluorides. Toxicol. Mech. Methods 21: 103–170, https://doi.org/10.3109/15376516.2010.542931.Search in Google Scholar
Rao, C.K. and Indusekhar, V. (1989). Distribution of certain cations and anions in seaweeds and seawater of Saurashtra coast and their geochemical significance. Indian J. Mar. Sci. 18: 37–42.Search in Google Scholar
Saenko, G.N., Kravtsova, Y.Y., Ivanenko, V.V., and Sheludko, S.I. (1978). Concentration of iodine and bromine by plants in the seas of Japan and Okhotsk. Mar. Biol. 47: 243–250, https://doi.org/10.1007/bf00541002.Search in Google Scholar
Saunders, G.W. (2005). Applying DNA barcoding to red macroalgae: a preliminary appraisal holds promise for future applications. Proc. Roy. Soc. Lond. B 360: 1879–1888, https://doi.org/10.1098/rstb.2005.1719.Search in Google Scholar
Schnetger, B. and Muramatsu, Y. (1996). Determination of halogens, with special reference to, iodine, in geological and biological samples using pyrohydrolysis for preparation and inductively coupled plasma mass spectrometry and ion chromatography for measurement. Analyst 121: 1627–1631, https://doi.org/10.1039/an9962101627.Search in Google Scholar
Sheppard, C.R.C. (1998). Biodiversity patterns in Indian Ocean corals, and effects of taxonomic error in data. Biodivers. Conserv. 7: 847–868, https://doi.org/10.1023/a:1008830222860.10.1023/A:1008830222860Search in Google Scholar
Sheppard, C., Al-Husiani, M., Al-Jamali, F., Al-Yamani, F., Baldwin, R., Bishop, J., and Zainal, K. (2010). The Gulf: a young sea in decline. Mar. Pollut. Bull. 60: 13–38, https://doi.org/10.1016/j.marpolbul.2009.10.017.Search in Google Scholar
Silberfeld, T., Leigh, J.W., Verbruggen, H., Cruaud, C., de Reviers, B., and Rousseau, F. (2010). A multi-locus time-calibrated phylogeny of the brown algae (Heterokonta, Ochrophyta, Phaeophyceae): investigating the evolutionary nature of the “brown algal crown radiation”. Mol. Phylogenet. Evol. 56: 659–674, https://doi.org/10.1016/j.ympev.2010.04.020.Search in Google Scholar
Silva, P.C., Basson, P.W., and Moe, R.L. (1996). Catalogue of the benthic marine algae of the Indian Ocean, vol. 79: University of California Publications in Botany, pp. 1–1259.Search in Google Scholar
Sullivan, D. and Zywicki, R. (2012). Determination of total iodine in foods and dietary supplements using inductively coupled plasma–mass spectrometry. J. AOAC Int. 95: 195–202, https://doi.org/10.5740/jaoacint.11-350.Search in Google Scholar
Thilly, C.H., Vanderpas, J.-B., Bebe, N., Ntambue, K., Contempre, B., Swennen, B., and Delange, F. (1992). Iodine deficiency, other trace elements, and goitrogenic factors in the etiopathogeny of iodine deficiency disorders (IDD). Biol. Trace Elem. Res. 32: 229, https://doi.org/10.1007/bf02784606.Search in Google Scholar
Tromp, M., Van, T.T., and Wever, R. (1991). Reactivation of vanadium bromoperoxidase - inhibition by metallofluoric compounds. Biochim. Biophys. Acta 1079: 53–56, https://doi.org/10.1016/0167-4838(91)90023-s.Search in Google Scholar
Truesdale, V.W., Luther, G.W., and Canosamas, C. (1995a). Molecular-Iodine Reduction in Seawater - an improved rate-equation considering organic compounds. Mar. Chem. 48: 143–150, https://doi.org/10.1016/0304-4203(94)00052-f.Search in Google Scholar
Truesdale, V.W., Luther, G.W.III, and Canosa-Mas, C. (1995b). Molecular iodine reduction in seawater, an improved rate equation considering organic compounds. Mar. Chem. 48: 143–150, https://doi.org/10.1016/0304-4203(94)00052-f.Search in Google Scholar
Tymon, T.M., Miller, E.P., Gonzales, J.L., Raab, A., Küpper, F.C., and Carrano, C.J. (2017). Some aspects of the iodine metabolism of the giant kelp Macrocystis pyrifera (Phaeophyceae). J. Inorg. Biochem. 177: 82–88, https://doi.org/10.1016/j.jinorgbio.2017.09.003.Search in Google Scholar
Venturi, S. and Venturi, M. (1999). Iodide, thyroid and stomach carcinogenesis: evolutionary story of a primitive antioxidant? Eur. J. Endocrinol. 140: 371–372, https://doi.org/10.1530/eje.0.1400371.Search in Google Scholar
Venturi, S., Donati, F.M., Venturi, A., and Venturi, M. (2000). Environmental iodine deficiency: a challenge to the evolution of terrestrial life? Thyroid 10: 727–729, https://doi.org/10.1089/10507250050137851.Search in Google Scholar
White, T.J., Bruns, T., Lee, S., and Taylor, J.W. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M.A., Gelfand, D.H., Sninsky, J.J., and White, T.J. (Eds.), PCR protocols: a guide to methods and applications. New York, NY: Academic Press, pp. 315–322.10.1016/B978-0-12-372180-8.50042-1Search in Google Scholar
WHO (2019). Preventing disease through healthy environments: inadequate or excess fluoride: a major public health concern. World Heal. Org.Search in Google Scholar
Yarrington, C.D. and Pearce, E.N. (2011). Dietary iodine in pregnancy and postpartum. Clin. Obstet. Gynecol. 54: 459–470, https://doi.org/10.1097/grf.0b013e31822ce2ff.Search in Google Scholar
Yoon, H.S., Hackett, J.D., and Bhattacharya, D. (2002). A single origin of the peridinin- and fucoxanthin-containing plastids in dinoflagellates through tertiary endosymbiosis. In: Proceedings of the National Academy of Sciences of the USA, 99, pp. 11724–11729, https://doi.org/10.1073/pnas.172234799.Search in Google Scholar
Young, E.G. and Langille, W. (1958). The occurrence of inorganic elements in marine algae of the Atlantic provinces of Canada. Can. J. Bot. 36: 301–310, https://doi.org/10.1139/b58-026.Search in Google Scholar
© 2020 Hanan Al-Adilah et al., published by De Gruyter, Berlin/Boston
This work is licensed under the Creative Commons Attribution 4.0 International License.
