Skip to content
BY 4.0 license Open Access Published by De Gruyter Open Access December 31, 2019

Anti-c-myc efficacy block EGFL7 induced prolactinoma tumorigenesis

  • Xiaolei Lan , Qian Liu , Hua Gao , Zhenye Li and Yazhuo Zhang EMAIL logo
From the journal Open Chemistry

Abstract

Resistance to Dopamine agonists therapy is still a key factor that hinders the clinical treatment of prolactinoma. Consequently, a large number of investigations have been carried out to identify novel therapeutic targets. Our previous studies have suggested that the epidermal growth factor-like domain 7 (EGFL7) plays a crucial role in tumorigenesis of pituitary adenomas via EGFR/AKT/MAPK signaling pathway. In the present research, we found a positive staining of c-myc intimately associated with high-level EGFL7 in invasive prolactinoma compared to non-invasive prolactinoma and the normal pituitary gland. Meanwhile, PI3K/Akt and MAPK signaling cascades closely related to the activation of c-myc. Therefore, this research was conducted to explore the cooperation effect of c-myc and EGFL7 in prolactinoma. The inhibition of c-myc with anti-c-myc antibodies significantly reduced the proliferation, PRL secretion and invasion of rat prolactinoma MMQ cells. Notably, down regulation c-Myc by in vitro administration of anti-c-Myc antibodies could significantly depress EGFL7 induced MMQ cell proliferation, PRL secretion and invasion. An anti-c-Myc antibody could block EGFL7 induced Akt activation, but the expression of p-ERK was not altered by an anti-c-Myc antibody. Thus, our results suggest that anti-c-myc efficacy could block EGFL7 induced prolactinoma tumorigenesis via inhibited Akt activation in MMQ cells.

1 Introduction

Prolactinoma are the most common tumors of pituitary adenoma with hyperprolactinemia [1]. Treatment with a dopamine agonist is effective in the inhibition of prolactin (PRL) secretion and tumor growth [2]. However, dopamine agonist-resistant to prolactinoma is still a key factor hindering prolactinoma treatment [3]. Therefore, novel and efficacious therapies are desired for these patients.

As a proto-oncogene, c‑myc enables cells grow infinitely and has been reported to initiate or accelerate tumorigenesis in a variety of tissues [4]. Prior studies have revealed that c-myc over-expression has an effect to turn tumor cells into malignant phenotypes by activating a cancer gene or deactivating its suppressors [5, 6]. This upregulation proceeds through multiple mechanisms, ranging from gene amplification, cellular senescence, to mutation of upstream signal pathways [7]. This research aims to examine the c‑myc over-expression levels in prolactinoma associated with the high level of EGFL7. However, the role of c-myc in prolactinoma remains to be completely elucidated.

Previously, we found EGFL7 played the tumorigenesis role in pituitary adenomas [8, 9]. Over-expression of EGFL7 is observed in growth hormone-producing pituitary adenomas [9] and prolactinoma [10]. Attenuation of EGFL7 expression Inhibits the tumor growth and invasion in vivo and in vitro experiments [9]. Furthermore, EGFL7 can act as a potential novel viable target for prolactinoma. In vitro administration of anti-EGFL7 antibodies induced prolactinoma cells apoptosis and plays an essential role in regulating biological behavior [10].

Our previous results showed that the MAPK and PI3K/AKT signaling pathway is a dominant driver in EGFL7 induced tumor growth and invasiveness [8,11]. Meanwhile, the PI3K/Akt and MAPK signaling cascades closely related to activation of c-myc [12]. Therefore, the current

study reveals the c-myc and EGFL7 cooperation effect in prolactinoma. It was found that the EGFL7 expression level was positively correlated with expression of c-myc in prolactinomas by using Tissue microarray (TMA). Using MTT, ELISA and Transwell assay, c-Myc-blocking antibody could block EGFL7 induced prolactinoma tumorigenesis. Down-stream signaling pathways studied investigated the biological process that is related to the phosphorylation of AKT.

2 Materials and Methods

2.1 Patients and specimens

Tissue samples from 126 patients with prolactinomas were provided by the biobank of Beijing Neurosurgical Institute [8]. All these patients had an endoscopic trans-sphenoidal operation between December 2012 and January 2014 at Tiantan Hospital, Beijing, China. There were 51 invasive specimens and 75 non-invasive specimens. The following invasive PAs diagnostic criteria were adopted: 1) Knosp classification grade III-IV tumors and Hardy classification III-IV; 2) Tumor cells confirmed via pathology as invading sellar bone or adjacent dura mater; 3) Tumor cells invading the sphenoid sinus cavity or peripheralvascular and nerve. We also collected anterior pituitaries glands from six organ donors whose deaths were irrelevant to neurological or endocrine diseases. For the sake of rooting out the possibility of incidental pathologies, all the normal anterior pituitaries were pathologically examined by immunohistochemistry. The study obtained approval from the Ethics Committee of Beijing Tiantan Hospital.

2.2 Immunohistochemistry

The immunohistochemical (IHC) SABC method was performed as depicted previously [9]. Prolactinoma and pituitary gland specimens were paraffin-embedded and put in 10% formaldehyde, and tissue sections of 4 μm were obtained through a standard hematoxylin-eosin (H&E) stain for histopathological evaluation. IHC analysis with rabbit recombinant monoclonal c‑myc (1:100, cat. ab32072; Abcam) and mouse monoclonal anti-EGFL7 antibody (1:100, cat. sc-101349; Santa) were conducted on the sections by random, automated, slide staining system Leica BOND-III (Leica Biosystems, Wetzlar, Germany). A Bond Polymer Refine Detection system (Leica Biosystems) was adopted to visualize the primary antibodies while an Aperio AT2 digital scanner (Leica Biosystems) was utilized to examine the expression of immunostained slides. The negative control sections received identical treatment other than omitting the primary antibody. Moreover, endothelial cells as a positive control obtained desirable results .

2.3 Cell culture

A rat prolactinoma cell MMQ was provided by American Type Culture Collection. MMQ cells were cultured in F12K medium added with 15% horse serum and 2.5% fetal bovine serum as well as 100 units/mL penicillin and streptomycin in a humidified air containing 5% CO2 at 4°C.

2.4 Cell proliferation assay

The proliferation of MMQ cells was assessed by an MTS assay following the manufacturers’ protocols. Briefly, MMQ cells were seeded into 96-well microplates and cultured in the medium mentioned above with 50 ng/mL recombinant human EGFL7 (rhEGFL7) or 10 μg/mL anti-c-myc antibodies for 72 h. Subsequently, a 20 μL MTS solution (Promega, Madison, WI, USA) was supplemented to each well with a 100 μL culture medium for four hours. The absorbance was assessed at 490 nm with a multi-detection microplate reader (Tecan Infinite® M200 pro). All experiments were performed in triplicate.

2.5 ELISA assay

A PRL RapidBio ELISA kit (West Hills, CA, USA) was used to evaluate the PRL secretions from MMQ cells as described previously [13]. According to the standard curve, standard density and OD, a linear regression equation was used to calculate the concentration of PRL. The color intensity of the reaction product was proportional to the concentration of PRL and was detected by the same multi-detector microplate reader mentioned in the cell proliferation test.

2.6 Western blot analyses

A DC Protein Assay (Bio-Rad) was applied to measure the concentrations of cell lysate protein [14]. Laemmli method was employed to resolve the same amounts of protein (40 μg) from each cell lysate. The proteins were transferred onto a 0.45-mm nitrocellulose membranes (Bio-Rad) which was sealed at 4°C and incubated overnight with the primary antibody. All the antibodies appeared as follows: anti-EGFL7 antibody (19291-1-AP, Proteintech), anti-p-ERK(ser42/44) antibody (#4696, CST), anti-AKT antibody (#4685, CST), anti-ERK antibody (#4685, CST) and GAPDH (Sigma) antibody, horseradish peroxidase-labeled secondary antibodies (Santa Cruz Bio.) Enhanced chemiluminescence was employed to visualize the membranes, and density measurements were performed by Amersham Imager 6000 (GE, American).

2.7 Quantitative real-time polymerase chain reaction (qRT-PCR) analysis

The purified total RNA (1μg) was reverse-transcribed into complementary deoxyribonucleic acid (cDNA) using a Revert Aid First-Strand cDNA Synthesis Kit (Thermo Shandon) based on the manufacturer’s protocol. The primer details of genes were described in Table 1. GAPDH was used as an endogenous control for normalizing the level of the target genes. qRT-PCR was performed on an ABI 7500 Fast Real-Time PCR System using the Platinum® SYBR® Green qPCR SuperMix-UDG (Invitrogen). A comparative CT method was used to calculate fold-change in the differential expression of each gene (2-△△CT method). PCR conditions: 50℃ 20 min, 95℃ 10 min, then 95℃ 10 secs to 60℃ 1 min, 40 cycles.

Table 1

The primers in RT-PCR experiment

GeneForwardRerverse
N-cadherinagaacagggtggacgtcattaccactgtgactagcccatc
MMP-2tgcaaccacaaccaactacgtagagctcctggatcccctt
MMP-9tgggcaagcagtactctaccgtcttcatgcagaggggagt
Vimentinactaatgagtccctggagcgaggtggcgatctcaatgtca
GAPDHagtctactggcgtcttcaccccacgatgccaaagttgtca

2.8 Statistical analysis

All data were expressed as the mean ± standard deviation (SD) of at least three independently performed experiments. Statistical analysis was conducted by SPSS 18.0 for Windows (SPSS Inc., Chicago, IL, USA). A one-way analysis of variance (ANOVA) was adopted to analyze the statistical significance of the differences among three groups, followed by a least significant difference post-hoc test to get individual P values. P value <0.05 was deemed as statistically significant.

3 Results

3.1 The positive staining of c-myc was intimately associated with high-level EGFL7 in invasive prolactinoma

Firstly, the expression level of c-myc and EGFL-7 was measured by using tissue microarray in invasive prolactinomas in comparison with normal pituitary and non-invasive prolactinomas. As illustrated in Figure 1, the positive staining of c-myc in invasive prolactinoma was significantly higher than that in non-invasive prolactinoma. The result showed that the average expression level of c-myc protein in invasive prolactinoma vs. non-invasive prolactinoma was about 2.05-fold increased (Figure 2A). In addition, total expression level of EGFL7 has been determined and presented in Figure 2B. As the result shown in Figure 2B, noticeably higher expression of EGFL7 was observed in invasive prolactinoma than non-invasive prolactinoma and normal pituitary. In addition, the correlation of overexpression of c-myc and EGFL7 was also analyzed. As illustrated in Figure 2C, the positive staining of c-myc was intimately associated with high-level EGFL7 in invasive prolactinoma (r=0.411; P<0.05. n=126).

Figure 1 Overexpression of c-myc and EGFL7 in invasive prolactinoma. Representative staining of a TMA was showed. c-myc and EGFL7 positive staining was significantly higher in invasive prolactinoma than that in non-invasive prolactinoma and normal pituitary. scale bar=60 μm.
Figure 1

Overexpression of c-myc and EGFL7 in invasive prolactinoma. Representative staining of a TMA was showed. c-myc and EGFL7 positive staining was significantly higher in invasive prolactinoma than that in non-invasive prolactinoma and normal pituitary. scale bar=60 μm.

Figure 2 Positively correlated of c-myc and EGFL7. H-scores of staining of TMA expressed as Mean ± SD. Both c-myc (A) and EGFL7 (B) overexpression in invasive prolactinoma. *P<0.05, **P<0.01 vs. non-invasive prolactinoma. In addition, (C) c-myc expression levels were significantly positively correlated with EGFL7 expression levels (r=0.411; P<0.05).
Figure 2

Positively correlated of c-myc and EGFL7. H-scores of staining of TMA expressed as Mean ± SD. Both c-myc (A) and EGFL7 (B) overexpression in invasive prolactinoma. *P<0.05, **P<0.01 vs. non-invasive prolactinoma. In addition, (C) c-myc expression levels were significantly positively correlated with EGFL7 expression levels (r=0.411; P<0.05).

3.2 Down regulation c-Myc depress EGFL7 induced cell proliferation and PRL secretion in MMQ cells

This research studied the role c-myc played in EGFL7-induced MMQ cell proliferation and PRL secretion in an effort to better understand the biological function of c-myc in the EGFL7 signaling pathway. Our previous investigation indicated that knockdown EGFL7 effectively inhibited pituitary adenoma cell growth [8, 9]. In this study, MMQ cells were incubated with 50 ng/mL rhEGFL7 protein or PBS for 72 h. As shown in Figure 3, 50 ng/mL rhEGFL7 significantly promote cell proliferation (Figure 3A, 1.88±0.37 fold) and PRL secretion (Figure 3B, 1.51± 0.32 fold). To further clarify whether c-myc is involved in EGFL7 induced cell growth, MMQ cells transfected with or without rhEGFL7 were performed with 10 μg/mL anti-c-myc antibodies. As shown in Figure 3A and 3B, down regulation c-Myc by anti-c-myc antibodies could depress EGFL7 induced cell proliferation and PRL secretion in MMQ cells.

Figure 3 anti-c-Myc antibody depress EGFL7 induced cell proliferation and PRL secretion in MMQ cells. Cell proliferation (A) and ELISA experiments (B) were performed to detect the cell proliferation and PRL secretion in MMQ cells incubated with or without rhEGFL7 and with anti-c-myc antibodies. **P<0.01 vs. rhEGFL7 (-) anti-c-myc antibodies (-), ##P<0.01 vs. rhEGFL7(+) anti-c-myc antibodies (-).
Figure 3

anti-c-Myc antibody depress EGFL7 induced cell proliferation and PRL secretion in MMQ cells. Cell proliferation (A) and ELISA experiments (B) were performed to detect the cell proliferation and PRL secretion in MMQ cells incubated with or without rhEGFL7 and with anti-c-myc antibodies. **P<0.01 vs. rhEGFL7 (-) anti-c-myc antibodies (-), ##P<0.01 vs. rhEGFL7(+) anti-c-myc antibodies (-).

3.3 Down regulation c-Myc could depress EGFL7 induced cell invasion

As our above results indicated, knockdown EGFL7 effectively inhibited the invasion and migration of pituitary adenoma. Thus, we measured the effect of down regulation c-Myc in EGFL7 induced cell invasion gene expression of MMQ cells. After incubation with or without rhEGFL7 and with anti-c-myc antibodies in MMQ cells, the mRNA level of invasion related genes N-cadherin, MMP2, MMP-9 and vimentin were measured by RT-PCR experiments. As shown in Figure 4, 50 ng/mL rhEGFL7 significantly enhance the level of MMQ cell invasion related genes N-cadherin (4.6 ± 1.2 fold), MMP-2 (3.8 ± 0.9 fold), MMP-9 (1.8 ± 0.3 fold) and vimentinin (2.9 ± 0.7 fold), and 10 μg/mL anti-c-myc antibodies could significantly inhibit cell invasion gene expression. Meanwhile, down regulation c-Myc by anti-c-myc antibodies could depress EGFL7 induced the level of cell invasion related genes in MMQ cells.

Figure 4 anti-c-Myc antibody depress EGFL7 induced cell invasion in MMQ cells. After incubated with or without rhEGFL7 and with anti-c-myc antibodies in MMQ cells, the relative mRNA level of invasion related genes N-cadherin, MMP2, MMP-9 and vimentinin were measured by RT-PCR experiments. **P<0.01 vs. rhEGFL7 (-) anti-c-myc antibodies (-), #P<0.05 vs. rhEGFL7(+) anti-c-myc antibodies (-). ##P<0.01 vs. rhEGFL7(+) anti-c-myc antibodies (-).
Figure 4

anti-c-Myc antibody depress EGFL7 induced cell invasion in MMQ cells. After incubated with or without rhEGFL7 and with anti-c-myc antibodies in MMQ cells, the relative mRNA level of invasion related genes N-cadherin, MMP2, MMP-9 and vimentinin were measured by RT-PCR experiments. **P<0.01 vs. rhEGFL7 (-) anti-c-myc antibodies (-), #P<0.05 vs. rhEGFL7(+) anti-c-myc antibodies (-). ##P<0.01 vs. rhEGFL7(+) anti-c-myc antibodies (-).

3.4 anti-c-Myc antibody could block EGFL7 induced Akt activation

The MAPK and PI3K/AKT signaling pathway are dominantly involved in EGFL7-induced tumor invasiveness. There are some studies reporting that EGFL7 is capable of interacting with AKT and ERK, by modulating EGFR signaling[15, 16]. Meanwhile, PI3K/Akt and MAPK signaling cascades are closely related to the activation of c-myc[12]. Thus, the present study explored whether the downregulation of c-Myc affects EGFL7-induced AKT and ERK activation. Protein extracts from MMQ cell transfected with or without 50 ng/mL rhEGFL7 and with 10 μg/mL anti-c-myc antibodies were detected by western blot, while the phosphorylation status of Akt and Erk in MMQ cells were measured. As seen in Figure 5, after 3 days’ treatment with 50 ng/ml rhEGFL7, it was observed that Akt (Figure 5A and Figure 5B) and Erk (Figure 5A and Figure 5C) phosphorylation levels in MMQ cells were markedly induced by rhEGFL7 in comparison with PBS control. However, anti-c-Myc antibody could block EGFL7 induced Akt activation, but the expression of p-ERK did not alter by anti-c-Myc antibody. Thus, our results suggest that anti-c-myc efficacy could block EGFL7 induced prolactinoma tumorigenesis via inhibited Akt activation in MMQ cells.

Figure 5 anti-c-Myc antibody block EGFL7 induced Akt activation. (A) The phosphorylation status of Akt and Erk in MMQ cells incubation with or without rhEGFL7 and with anti-c-myc antibodies were measured by western blot. Protein level of p-Akt/Akt (B) and p-Erk/Erk (C) expressed as Mean ± SD. **P<0.01 vs. rhEGFL7 (-) anti-c-myc antibodies (-), ##P<0.01 vs. rhEGFL7(+) anti-c-myc antibodies (-).
Figure 5

anti-c-Myc antibody block EGFL7 induced Akt activation. (A) The phosphorylation status of Akt and Erk in MMQ cells incubation with or without rhEGFL7 and with anti-c-myc antibodies were measured by western blot. Protein level of p-Akt/Akt (B) and p-Erk/Erk (C) expressed as Mean ± SD. **P<0.01 vs. rhEGFL7 (-) anti-c-myc antibodies (-), ##P<0.01 vs. rhEGFL7(+) anti-c-myc antibodies (-).

4 Discussions

The proteins c‑myc and EGFL7 have been previously reported to be potent markers of tumor development in a wide range of solid tumors [17, 18, 19, 20]. It was observed that the expression of c‑myc had a sharp upregulation at a relatively late stage of prostate cancer, suggesting that correlated with tumor invasion and metastasis [21]. Many pieces of evidence revealed that anti-EGFL7 inhibited tumor growth and enhanced the antiangiogenesis [22, 23]. Our previous results indicated a significantly higher expression of EGFL7 in hormone-secreting pituitary adenomas, which was associated with poor prognosis and invasiveness of tumor cells [8, 9]. So far, very few studies have investigated the correlation of c‑myc and EGFL7 with tumorigenesis and invasion clinicopathological parameters in prolactinoma.

Therefore, the current study is probably a pioneering study with the aim to explore the association between them. The study has investigated the correlation of c‑myc and EGFL7 proteins with invasion in prolactinoma by IHC on tissue microarrays. The data demonstrated that both c‑myc and EGFL7 were over-expressed in invasive prolactinoma in comparison with the non‑invasive prolactinoma and the normal pituitary tissues. Meanwhile, the positive staining of c-myc was strongly linked with high-level EGFL7 in invasive prolactinoma. Thus, c‑myc and EGFL7 was further demonstrated to be potential and potent biological markers for the detection of invasive prolactinoma.

The EGFL7 protein sequence is composed of an amino-terminal signal peptide domain, an EMI, and two centrally located EGF-like domains [24]. Predecessor research results have indicated EGFL7 binds to EGFR with EGF-like domains. Our previous study showed that EGFL7 knockdown has an effect on EGFR signaling cascades [8]. EGFR led to auto-phosphorylation of tyrosine residues with the result that a multitude of downstream signaling pathways were activated, containing protein kinase B (AKT/PKB) and mitogen-activated protein kinase (MAPK) pathways [25]. Meanwhile, PI3K/Akt and MAPK signaling cascades closely related to activation of c-myc [26]. To further investigate the cooperation effect of c-myc and EGFL7 in prolactinoma, MMQ cells were incubated with a 50 ng/mL recombinant human EGFL7rhEGFL7and anti-cmy antibodies were added for down-regulation c-myc level. we compared the cell ability, PRL releasing and invasion gene expression of MMQ cells. The results after the two treatments with rhEGFL7 suggested that cell growth and invasion were inhibited. Moreover, down regulation of c-Myc by anti-c-myc antibodies could depress EGFL7 induced cell proliferation and invasion in MMQ cells (Figure 1-4). To further clarify the effect of c-myc knockdown on EGFL7 induce signaling cascades, we detected the AKT and ERK activation from MMQ cells transfected with or without rhEGFL7 were performed with 10 μg/mL anti-c-myc antibodies. Interestingly, the EGFL7 induced activation of AKT was significantly suppressed by c-myc antibody, but activation of ERK was not changed (Figure 5). These results with both treatments showed the positive interreaction of c-myc and EGFL7 in biological function of MMQ cells and may correlate with Akt activation.

In the present study, we report for the positive interaction between c-myc and EGFL7 in prolactinoma. We also demonstrated that down regulation c-Myc with antibody could depress EGFL7 induced cell proliferation, PRL secretion and invasion of MMQ cells. In brief, our finding suggests that anti-c-myc efficacy block EGFL7 induced prolactinoma tumorigenesis. Thus, c-myc and EGFL7 may serve as a potential novel viable target for treatment of prolactinomas.

Acknowledgements

This work was financially supported by the Beijing Natural Science Foundation of China (No. 81601205) and National Natural Science Foundation of China (81502154, 81601205).

  1. Conflict of interest: The authors declare that they have no competing interests.

References

[1] Glezer A., Bronstein M.D., Prolactinoma, Arq. Bras. Endocrinol. Metabol., 2014, 58(2), 118-123.10.1590/0004-2730000002961Search in Google Scholar PubMed

[2] Levin G., Rottenstreich A., Prolactin, prolactin disorders, and dopamine agonists during pregnancy, Hormones (Athens). 2019, 18(2),137-139.10.1007/s42000-018-0071-zSearch in Google Scholar PubMed

[3] Oh M.C., Aghi M.K., Dopamine agonist-resistant prolactinomas, J. Neurosurg., 2011, 114(5), 1369-1379.10.3171/2010.11.JNS101369Search in Google Scholar PubMed

[4] Conacci-Sorrell M., McFerrin L., Eisenman R.N., An overview of MYC and its interactome, Cold. Spring. Harb. Perspect. Med., 2014, 4(1), a014357.10.1101/cshperspect.a014357Search in Google Scholar PubMed PubMed Central

[5] Sadeghi S., Hojati Z., Tabatabaeian H., Cooverexpression of EpCAM and c-myc genes in malignant breast tumours, J. Genet. 2017, 96(1), 109-118.10.1007/s12041-017-0748-0Search in Google Scholar PubMed

[6] Trudel M., c-Myc Signalling in the Genetic Mechanism of Polycystic Kidney Disease, In. Polycystic. Kidney. Disease., Li, X., Ed. Brisbane (AU), 2015.10.15586/codon.pkd.2015.ch10Search in Google Scholar PubMed

[7] Wright J.B., Brown S.J., Cole M.D., Upregulation of c-MYC in cis through a large chromatin loop linked to a cancer risk-associated single-nucleotide polymorphism in colorectal cancer cells, Mol. Cell. Biol. 2010, 30(6), 1411-1420.10.1128/MCB.01384-09Search in Google Scholar PubMed PubMed Central

[8] Liu Q., Zhang J., Gao H., Yuan T., Kang J., Jin L.,et al., Role of EGFL7/EGFR-signaling pathway in migration and invasion of growth hormone-producing pituitary adenomas, Sci. China. Life. Sci., 2018, 61(8), 893–901.10.1007/s11427-018-9320-4Search in Google Scholar PubMed

[9] Liu Q., Wang J., Yang H., Gao H., Li C., Lan X., et al., Attenuation of EGFL7 Expression Inhibits Growth Hormone-Producing Pituitary Adenomas Growth and Invasion, Hum. Gene. Ther. 2018, (in press), DOI: 10.1089/hum.2017.200.10.1089/hum.2017.200Search in Google Scholar PubMed

[10] Liu Q., Yuan T.Y., Gao H., Gui S.B., Zhang Y.Z., Li C.Z., Anti-EGFL7 antibodies inhibit rat prolactinoma MMQ cells proliferation and PRL secretion, Open. Chemistry, 2018, 16, 621-626.10.1515/chem-2018-0064Search in Google Scholar

[11] Huang C., Yuan X., Wan Y., Liu F., Chen X., Zhan X., et al., VE-statin/Egfl7 expression in malignant glioma and its relevant molecular network, Int. J. Clin. Exp. Pathol., 2014, 7(3), 1022-1031.Search in Google Scholar

[12] Zhu J., Blenis J., Yuan J., Activation of PI3K/Akt and MAPK pathways regulates Myc-mediated transcription by phosphorylating and promoting the degradation of Mad1, Proc. Natl. Acad. Sci. U.S.A., 2008, 105(18), 6584-6589.10.1073/pnas.0802785105Search in Google Scholar PubMed PubMed Central

[13] Cao L., Gao H., Li P., Gui S., Zhang Y., The Wnt/beta-catenin signaling pathway is involved in the antitumor effect of fulvestrant on rat prolactinoma MMQ cells, Tumour. biology, 2014, 35(6), 5121-5127.10.1007/s13277-013-1571-8Search in Google Scholar PubMed

[14] Li Z., Liu Q., Li C., Zong X., Bai J., Wu Y., et al., The role of TGF-beta/Smad signaling in dopamine agonist-resistant prolactinomas, Mol. Cell. Endocrinol., 2015, 402, 64-71.10.1016/j.mce.2014.12.024Search in Google Scholar PubMed

[15] Massimiani M., Vecchione L., Piccirilli D., Spitalieri P., Amati F., Salvi S., et al., Epidermal growth factor-like domain 7 promotes migration and invasion of human trophoblast cells through activation of MAPK, PI3K and NOTCH signaling pathways, Mol. Hum. Reprod., 2015, 21(5), 435-451.10.1093/molehr/gav006Search in Google Scholar PubMed PubMed Central

[16] Lim W., Park S., Bazer F.W., Song G., Apigenin Reduces Survival of Choriocarcinoma Cells by Inducing Apoptosis via the PI3K/ AKT and ERK1/2 MAPK Pathways, J. Cell. Physiol, 2016, 231(12), 2690-2699.10.1002/jcp.25372Search in Google Scholar PubMed

[17] Shimizu T., Ishikawa T., Sugihara E., Kuninaka S., Miyamoto T., Mabuchi Y., et al., c-MYC overexpression with loss of Ink4a/Arf transforms bone marrow stromal cells into osteosarcoma accompanied by loss of adipogenesis, Oncogene., 2010, 29(42), 5687-5699.10.1038/onc.2010.312Search in Google Scholar PubMed

[18] Su Y., Pelz C., Huang T., Torkenczy K., Wang X., Cherry A., et al., Post-translational modification localizes MYC to the nuclear pore basket to regulate a subset of target genes involved in cellular responses to environmental signals, Genes. Dev., 2018, 32(21-22), 1398-1419.10.1101/gad.314377.118Search in Google Scholar PubMed PubMed Central

[19] Dudvarski Stankovic N., Bicker F., Keller S., Jones D.T., Harter P.N., Kienzle, A., et al., EGFL7 enhances surface expression of integrin alpha5beta1 to promote angiogenesis in malignant brain tumors, EMBO. Mol. Med. 2018, 10(9), pii: e8420.Search in Google Scholar

[20] Rattanapan Y., Korkiatsakul V., Kongruang A., Chareonsirisuthigul T., Rerkamnuaychoke B., Wongkularb A., et al., EGFL7 and RASSF1 promoter hypermethylation in epithelial ovarian cancer, Cancer. Genet., 2018, 224-225, 37-40.10.1016/j.cancergen.2018.04.117Search in Google Scholar PubMed

[21] Inamura N., Kimura T., Wang L., Yanagi H., Tsuda M., Tanino M., et al., Notch1 regulates invasion and metastasis of head and neck squamous cell carcinoma by inducing EMT through c-Myc, Auris. Nasus. Larynx., 2017, 44(4), 447-457.10.1016/j.anl.2016.08.003Search in Google Scholar PubMed

[22] Johnson L., Huseni M., Smyczek T., Lima A., Yeung S., Cheng J.H., et al., Anti-EGFL7 antibodies enhance stress-induced endothelial cell death and anti-VEGF efficacy, J, Clin. Invest., 2013, 123(9), 3997-4009.10.1172/JCI67892Search in Google Scholar PubMed PubMed Central

[23] Oh J., Park S.H., Lee T.S., Oh H.K., Choi J.H., Choi Y.S., High expression of epidermal growth factor-like domain 7 is correlated with poor differentiation and poor prognosis in patients with epithelial ovarian cancer, J. Gynecol. Oncol., 2014, 25(4), 334-341.10.3802/jgo.2014.25.4.334Search in Google Scholar PubMed PubMed Central

[24] Parker L.H., Schmidt M., Jin S.W., Gray A.M., Beis D., Pham T., et al., The endothelial-cell-derived secreted factor Egfl7 regulates vascular tube formation, Nature., 2004, 428(6984), 754-758.10.1038/nature02416Search in Google Scholar PubMed

[25] Jabbarzadeh Kaboli P., Leong M.P., Ismail P., Ling K.H., Antitumor effects of berberine against EGFR, ERK1/2, P38 and AKT in MDA-MB231 and MCF-7 breast cancer cells using molecular modelling and in vitro study, Pharmacol. Rep., 2018, 71(1), 13-23.10.1016/j.pharep.2018.07.005Search in Google Scholar PubMed

[26] Lee Y. J., Jung O., Lee J., Son J., Cho J.Y., Ryou C., et al., Maclurin exerts anti-cancer effects on PC3 human prostate cancer cells via activation of p38 and inhibitions of JNK, FAK, AKT, and c-Myc signaling pathways, Nutr. Res., 2018, 58, 62-71.10.1016/j.nutres.2018.07.003Search in Google Scholar PubMed

Received: 2018-10-31
Accepted: 2019-05-15
Published Online: 2019-12-31

© 2019 Xiaolei Lan et al., published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 Public License.

Downloaded on 4.3.2024 from https://www.degruyter.com/document/doi/10.1515/chem-2019-0151/html
Scroll to top button