Skip to content
BY-NC-ND 3.0 license Open Access Published by De Gruyter May 15, 2015

Effect of caffeine on Alzheimer’s molecular factors in correlation with involved cell communication systems in developing zebrafish Danio rerio

Wirkung von Koffein auf die molekularen Faktoren der Alzheimer-Krankheit in Korrelation mit den beteiligten Zellkommunikationssystemen bei der Entwicklung von Zebrafisch Danio rerio
Tamer Said Abdelkader, Seo-Na Chang, Ji-Min Lee, JuHa Song, Hanseul Oh and Jae-Hak Park
From the journal LaboratoriumsMedizin

Abstract

Background: Epidemiological studies suggested that caffeine/coffee could be an effective therapeutic agent against Alzheimer disease (AD). The mechanism has not been well established; however, molecular genetic analyses suggest that many genes influence it.

Methods: Using developing zebrafish (Danio rerio), we studied the regulatory effect of caffeine on AD molecular factors, APP, Psen1, Psen2, ApoE, and Sorl1, and on receptor expression of two cell communication systems involved in the disease, adenosine (AR) and dopamine receptors (DR).

Results: All genes are already expressed at early developmental stages. No morphological changes were found at tested concentrations and control. Caffeine significantly down-regulated the expression of all AD tested genes at 24 h post-fertilization (hpf) and APP, Sorl1, and Psen1 at 96 and 168 hpf. A2aa and A2ab receptors have higher affinity for caffeine than A2b. Significant down-regulation occurred in A2b at 168 hpf in both concentrations. Caffeine blocked the expression of drd2a and drd2c at 24 hpf but significantly stimulated the expression at 96 and 168 hpf.

Conclusions: Zebrafish is a promising organism in studying AD at the molecular level because all tested factors are already expressed at early developmental stages. Caffeine has a regulatory effect on all tested genes and may protect against the disease via amyloid pathway as well as AR and DR.

Zusammenfassung

Hintergrund: Epidemiologische Studien geben zur Annahme Anlass, dass Koffein/Kaffee ein wirksames therapeutisches Mittel gegen Alzheimer (AD) sein könnte. Der Mechanismus ist noch nicht klar genug nachgewiesen, jedoch deuten molekulargenetische Analysen darauf hin, dass viele Gene ihn beeinflussen.

Methoden: Mit der Entwicklung von Zebrafisch untersuchten wir die regulierende Wirkung von Koffein auf AD molekulare Faktoren; von APP, Psen1, Psen2, ApoE und Sorl1 auf Expressionen von Rezeptoren von zwei von der Krankheit befangenen Zellkommunikationssystemen und jeweils auf Adenosin und Dopamin-Rezeptoren.

Ergebnisse: Alle Gene sind bereits in frühen Entwicklungsstadien ausgedrückt. Es wurden keine morphologischen Veränderungen bei getesteten Konzentrationen und der Kontrolle festgestellt. Koffein hat den Ausdruck aller AD getesteten Gene signifikant nach 24 Stunden nach der Befruchtung (hours post-fertilization – hpf) herunterreguliert und APP, SORL1 und PSEN1 nach 96 hpf und 168 hpf herunterreguliert. A2aa- und A2ab-Rezeptoren besitzen eine höhere Affinität für Koffein als A2b. Eine wesentliche Herabregulierung trat für A2b bei 168 hpf in beiden Konzentrationen auf. Koffein blockierte die Expression von drd2a und drd2c bei 24 hpf, stimulierte jedoch die Expression bei 96 und 168 hpf deutlich.

Schlussfolgerungen: Zebrafisch ist vielversprechend als ein Organismus zum Studium von AD auf molekularer Ebene, da alle untersuchten Faktoren bereits in frühen Entwicklungsstadien ausgedrückt sind. Koffein wirkt regulierend auf alle getesteten Gene und kann gegen die Krankheit über Amyloid-Weg sowie auch durch Adenosin- und Dopaminrezeptoren seine Schutzwirkung entfalten.

Introduction

Epidemiological studies have increasingly suggested that caffeine/coffee could be an effective therapeutic agent against Alzheimer disease (AD) [1]. AD is the most common form of neurodegenerative disease, with more than 20 million cases worldwide [2]. The mechanism in which caffeine may protect against AD has not been well established; nevertheless, molecular genetic analyses suggest that there are likely to be many genes that influence one’s susceptibility to AD [3].

AD is generally characterized by the presence of neurofibrillary tangles and amyloid deposits that form plaques and cerebrovascular accumulations [4]. Extensive research on the mechanisms that underlie the disease has led to the identification of a number of genetic, environmental, and lifestyle factors that significantly contribute to increased risk of developing AD and play major roles in the pathogenesis of the disease [5]. However, those genes may increase the risk of developing the disease, and the most well-established link between AD and genetics is in familial early-onset AD. The discovery of genetic aberrances that either cause or increase the risk of AD heralded a rapid increase in the knowledge of the molecular and cellular alterations responsible for neuronal degeneration and cognitive dysfunction in AD [6]. One of the most intensively studied molecules is APP [7, 8]. It is known as the main controller of senile plaques that accumulate in the brain and cause neurologic disorders. Enormous scientific efforts have been put into APP-related studies mainly because of its vital pathophysiological functions in AD [9]. Two other genes linked to early-onset familial AD are those encoding Psen1 and Psen2. They are structurally similar integral membrane proteins with eight transmembrane domains and are localized mainly in the endoplasmic reticulum (ER). The presenilin proteins have been shown to play important roles in apoptosis, calcium homeostasis, cell cycle regulation, regulation of misfolded proteins in the ER, and cleavage of APP [10].

Also, one of the most widely studied risk factors for sporadic AD is apolipoprotein E (ApoE). An allele of this gene, ApoE4, has been associated with increased risk for late-onset AD. People who carry one or two copies of the ApoE ε4 allele carry an increased risk of developing AD; however, the ε4 allele is not necessary or sufficient to cause AD [11]. ApoE associates with lipoprotein particles and facilitates their interaction with lipoprotein receptors [12]. The gene coded by Sorl1 is a neuronal ApoE receptor. The lack of the ApoE receptor is suspected to be a contributory factor to AD [13].

For decades now, zebrafish (Danio rerio) have become a promising model in many research areas, including neuroscience, developmental biology, and toxicology [14–17]. Three distinct zebrafish adenosine receptors (ARs), A2aa, A2ab, and A2b, were discovered [18]. Adenosines are biological endogenous purine nucleosides that modulate a variety of physiological processes. They play an important role in signal transduction, which increases drastically during brain ischemia caused by stroke. They are also potent anti-inflammatory agents that play an important role in tissue protection and repair [19]. In the central nervous system, adenosine is involved in regulating neurotransmitter release as well as postsynaptic neuronal responses [20].

The effects of the modulation of A2a gene expression on normal aging and in pathological conditions as AD are still unclear, but the use of non-selective antagonists like caffeine to treat AD-related cognitive deficits is showing promising results [18, 21, 22]. In our present work, we tested the effect of caffeine on the mRNA expression of a package of confirmed AD-involved genes in two concentrations, 10 and 100 μM, and analyzed the correlation of two major transmitter systems in the cell communications systems, adenosine (A2aa, A2ab, and A2b) and dopamine (drd2a and drd2c) receptors, with mRNA expression in order to understand the mechanisms of the disease in this model and improve the pharmaceuticals for this disease.

Materials and methods

Zebrafish maintenance

Zebrafish (Dario rerio) were obtained locally and maintained under our established laboratory housing system. Adult zebrafish were kept in glass aquaria under recirculation system with a photoperiod cycle of 14 and 10 h, light and dark, respectively, and temperature of 28 °C. They were fed three times a day with commercial dried pellet (Tetra Werke, Melle, Germany).

Breeding and egg collection

Two pairs of males and females were kept separately in spawning plastic boxes containing a mesh bottom to prevent the spawned eggs from being cannibalized. The mating boxes were incubated overnight for about 10 h in a 28 °C incubator. On the next day, the barriers were removed at the beginning of the light period to allow mating and spawning. We followed the Care and Treatment of the Animals guidelines by the Institutional Animal Care and Use Committee, Seoul National University (approval no. SNU-050418-2). The technical procedures were according to the zebrafish guidelines book [23].

Caffeine solutions and exposure

A stock solution with a concentration of 1 mM was prepared by dissolving caffeine powder (1,3,7-trimethylxanthine; Reagent plus W, powder, CAS no. 58-08-2; Sigma-Aldrich, Seoul, South Korea) in distilled water then diluted to obtain 10- and 100-μM concentrations.

Experiment design

The fertilized eggs were collected and washed twice with E3 medium (embryo medium) [23]. About 2 hpf (cleavage stage 32–64 cells), eggs were distributed randomly into three 12-well plates to start exposure, one plate for each checkpoint. The plates were filled with 3 mL of exposure solution 10 μM, exposure solution 100 μM, or distilled H2O in three biological replicates for each treatment. At 24 hpf, the embryos from the first plate were prepared for molecular analysis. A 1.5-mL exposure solution of the other plates was replaced with a fresh one daily until the end of the experiment.

Monitoring assay

Hatching, survival rate, and phenotype abnormalities were monitored in all experimental sets. Monitoring assays were applied separately in another 12-well plate to check the morphological change from 24 hpf until 168 hpf, once every 24 h.

Molecular analysis

Embryos from each treatment were pooled and prepared for total RNA extraction using the protocol provided by Chen Laboratories, Department of Chemical and Systems Biology, Stanford University [24]. cDNAs were synthesized from extracted total RNA using TOPscript™ cDNA Synthesis kit (CAT EZ005S). Polymerase chain reaction (PCR) was performed according to kit provider guidelines (AccuPower® PCR PreMix, Cat: K-2016). The reactions were done by mixing 1 μL cDNA, 1 μL forward primer, and 1 μL reverse primer with distilled water until the mixture reaches 20 μL. The thermal cycling protocol was 95 °C for 3 min, followed by 40 cycles at 95 °C for 10 s, 60 °C for 30 s, and 72 °C for 40 s, then one cycle at 72 °C for 2 min. Band intensity was measured by ImageJ program (http://imagej.nih.gov/ij/index.html). Real-time (RT)-PCR (qPCR) was performed according to Takara Bio guidelines. A 25-μL RT-PCR reaction was done by adding 1 μL cDNA, 1 μL forward primer, 1 μL reverse primer, 12.5 μL SYBR Premix Ex Taq (Takara Bio, Shiga, Japan), and 9.5 μL of nuclease-free water (Ambion, Austin, TX, USA) to give the reaction a final volume of 25 μL. The reaction was performed using a Bio-Rad Real Time PCR System (CFX Connect™ Real-Time PCR Detection System and CFX Manager Version 2.1.1022.0523 to analyze data) according to the company’s instructions. The thermal profile for RT-PCR was 95 °C for 3 min, followed by 40 cycles at 95 °C for 10 s, 60 °C for 30 s, and 72 °C for 40 s. We used β-actin as a housekeeping gene to normalize the results by eliminating variations in mRNA and cDNA quantity and quality. Three technical replicates of each RNA sample were performed. Relative mRNA expression for each gene was calculated as fold change compared with the control group using 2ΔΔct formula method. All primers used in this experiment are described in Table 1.

Table 1

Genes identification and specific primers used in PCR and Real Time – PCR analysis.

No.GeneAccession numberForward primerReverse primerProduct size, bp
1β-ActinBC067566.1AAGGCCAACAGGGAAAAGATAGGGCGTAACCCTCGTAGAT176
2APPBC068375.1CGACCAGTGTCTGGACTGAAGCTTCTTCCTCAGCATCACC205
3Psen1BC054639.1CAGTCCCTCAGCAGGAGAACAAATCTCCCAAACCCAGCTT223
4Psen2BC065382.1ATTCTGTCCTCGCTGATGCTATGAAGATGAGGGCCATGAG215
5ApoEBC154034.1ATGCAGTGAAGGAAGGACCGTTTCCGTAGGTTCTCGGCTGTCT175
6Sorl1XM003200038.2CCATACATGGGTCCTCCATCGCTCTCGGTTTTTCGAACTG195
7A2aaNM_001039815.1ATCATCGTTGGTTTGTTCGCCCCACTGAGTTTGCGTGTGAGA139
8A2abNM_001040036.1CCGAGAGGAAGTCTCCTCCACCAGCCACATTCGGGTCAT197
9A2bNM_001039813.2GGATTCGCTCTACATCGCCAAGTGATGGCAAAGGGGATGG181
10Drd2aAY183456.1ACATCTTCGTCACCCTGGACCGCAATCACACAGAGAGCAT242
11Drd2cAY333792.1TTATGCCCTGGGTGGTGTATCCCGTCTCTTGGAGCTGTAG195

Statistical analysis

Relative mRNA expression results were shown as the mean±SE of relative normalized expression of RT-PCR values. We performed two-way analysis of variance (ANOVA) to analyze the data, followed by Tukey multiple comparison tests. The results of the optical density of mRNA expression were also analyzed using two-way ANOVA followed by Bonferroni post-tests (*significant difference occurred for a given parameters when p<0.05; **high significance when p<0.01). The entire statistical analysis was carried out using Graphpad Prism (Version 4.03).

Results

Monitoring assay

A caffeine concentration of 100 μM, which has no effect on the locomotor activity, has been approved previously. Here, we did not observe morphological abnormalities during the experiment in both concentrations as well as in the control. Hatching started at about 48 hpf in all treatments and control. There was no difference in the overall hatching rate between treatments and control (data not shown). The overall survival rates were 84%, 78%, and 76% for control, 10 μM, and 100 μM, respectively, with no significant difference (p>0.05) (Figure 1).

Figure 1: Survival rate of developing zebrafish after exposure to caffeine.We checked the survival rate every 24 h from 24 to 168 hpf. Values represent the means±SE.

Figure 1:

Survival rate of developing zebrafish after exposure to caffeine.

We checked the survival rate every 24 h from 24 to 168 hpf. Values represent the means±SE.

Molecular analysis

Caffeine treatment was conducted to zebrafish embryos at three different ages, 24, 96, and 168 hpf, to assess the effects of all selected genes on mRNA expression. All tested genes are already expressed during early developmental stages.

Optical density of AR expression

We analyzed the expression of each AR by measuring the optical density of mRNA expression using ImageJ software. Caffeine altered the mRNA expression of all tested receptors (Figure 2). At 24 hpf, 10 μM of caffeine significantly up-regulated the expression of A2aa and A2ab genes (p<0.05) and highly significantly up-regulated the expression at 100 μM (p<0.02). The changes in expression at 96 and 168 hpf had no significant difference with the control, except at 100 μM (p<0.05). The effect of caffeine on AR A2b was controversial because of the fluctuation of its expression at the different check points.

Figure 2: Effect of caffeine on the gene expression of ARs at 24, 96, and 168 hpf.Embryos from each treatment were pooled and prepared for total RNA extraction. cDNAs were synthesized from extracted total RNA. PCR was performed according to kit provider guidelines. The reactions were done by mixing 1 μL cDNA, 1 μL forward primer, and 1 μL reverse primer with distilled water until the mixture reaches 20 μL. The thermal cycling protocol was (95 °C for 3 min, followed by 40 cycles at 95 °C for 10 s, 60 °C for 30 s, and 72 °C for 40 s, then one cycle at 72 °C for 2 min. Band intensity was measured by ImageJ program. A2aa is adenosine receptor 2aa, A2ab is adenosine receptors 2ab, and A2b is adenosine receptor 2b. *Significant difference with control (p<0.05); **high significant difference with control (p<0.02).

Figure 2:

Effect of caffeine on the gene expression of ARs at 24, 96, and 168 hpf.

Embryos from each treatment were pooled and prepared for total RNA extraction. cDNAs were synthesized from extracted total RNA. PCR was performed according to kit provider guidelines. The reactions were done by mixing 1 μL cDNA, 1 μL forward primer, and 1 μL reverse primer with distilled water until the mixture reaches 20 μL. The thermal cycling protocol was (95 °C for 3 min, followed by 40 cycles at 95 °C for 10 s, 60 °C for 30 s, and 72 °C for 40 s, then one cycle at 72 °C for 2 min. Band intensity was measured by ImageJ program. A2aa is adenosine receptor 2aa, A2ab is adenosine receptors 2ab, and A2b is adenosine receptor 2b. *Significant difference with control (p<0.05); **high significant difference with control (p<0.02).

Optical density of dopamine receptors mRNA expression

The expression of dopamine receptors (DRs) was also analyzed by measuring the optical density of mRNA expression (Figure 3). Although the expressions of both receptors were low at 24 hpf in control, caffeine almost blocked the signal, especially in 100 μM, with significant difference compared with control (p<0.05). Interestingly, 10 and 100 μM of caffeine significantly up-regulated the expression of drd2a at 96 and 168 hpf, respectively, and non-significantly at other checkpoints. Also, caffeine significantly up-regulated the expression of drd2c at both 10- and 100-μM concentrations at 96 hpf and at 100-μM concentration at 168 hpf.

Figure 3: Effect of caffeine on the gene expression of DRs at 24, 96, and 168 hpf.Embryos from each treatment were pooled and prepared for total RNA extraction. cDNAs were synthesized from extracted total RNA. PCR was performed according to kit provider guidelines. The reactions were done by mixing 1 μL cDNA, 1 μL forward primer, and 1 μL reverse primer with distilled water until the mixture reaches 20 μL. The thermal cycling protocol was 95 °C for 3 min, followed by 40 cycles at 95 °C for 10 s, 60 °C for 30 s, and 72 °C for 40 s, then one cycle at 72 °C for 2 min. Band intensity was measured by ImageJ program. drd2a is dopamine receptor 2a and drd2c is dopamine receptor 2c. *Significant difference with control (p<0.05); **high significant difference with control (p<0.02).

Figure 3:

Effect of caffeine on the gene expression of DRs at 24, 96, and 168 hpf.

Embryos from each treatment were pooled and prepared for total RNA extraction. cDNAs were synthesized from extracted total RNA. PCR was performed according to kit provider guidelines. The reactions were done by mixing 1 μL cDNA, 1 μL forward primer, and 1 μL reverse primer with distilled water until the mixture reaches 20 μL. The thermal cycling protocol was 95 °C for 3 min, followed by 40 cycles at 95 °C for 10 s, 60 °C for 30 s, and 72 °C for 40 s, then one cycle at 72 °C for 2 min. Band intensity was measured by ImageJ program. drd2a is dopamine receptor 2a and drd2c is dopamine receptor 2c. *Significant difference with control (p<0.05); **high significant difference with control (p<0.02).

Relative quantitative of AD gene expression

All selected genes involved in the AD pathway, APP, Psen1, Psen2, ApoE, and Sorl1, are also already expressed at early developmental stages of zebrafish embryos. First, the control was adjusted to a value of 1, and the expression changes of all tested genes were calculated as fold change compared to the control. Caffeine altered the gene expression at most checkpoints (Figure 4). A down-regulation occurred at the expression at 24 hpf. A caffeine concentration of 10 μM significantly (p<0.05) down-regulated all tested genes except APP. A highly significant (p<0.01) down-regulation occurred in 100-μM caffeine treatment. The highest down-regulation was found in the APP gene, about 0.4-fold compared to control. Thus, at 24 hpf, caffeine down-regulated the expression all tested genes and the effect increases with the higher concentration, 100 μM. At 96 hpf, continuous exposure to caffeine showed a different effect on the expression of all the tested genes. With the 10-μM treatment, Sorl1, ApoE, and Psen2 genes were down-regulated by 0.6-, 0.6-, and 0.5-fold change, respectively, with significant difference with control (p<0.05). At 100-μM treatment, the down-regulation was non-significant in Sorl1 and Psen1, with ∼0.9-fold changes with control. The 10-μM caffeine concentration significantly up-regulated the expression of APP and Psen1 by 1.2- and 1.9-fold changes in control; however, the 100-μM treatment significantly up-regulated the expression of APP and Psen2 by 2.6- and 1.2-fold changes, respectively, with control and non-significantly in ApoE by 1.1-fold change. To identify expression pattern, mRNAs from developing zebrafish larvae at 168 hpf were analyzed after the completion of neurodevelopment. Caffeine significantly down-regulated Sorl1 and APP at 10 and 100 μM, but Psen1 was only down-regulated at a caffeine concentration of 100 μM. ApoE was down-regulated in the 10- and 100-μM treatments, with no significant difference with control. Also, the down-regulation of Psen1 was non-significant in the 10- and 100-μM treatments.

Figure 4: Effect of caffeine on the gene expression of AD-involved genes at 24, 96, and 168 hpf.Bars represent the means±SE. RT-PCR (qPCR) was performed according to Takara Bio guidelines. A 25-μL RT-PCR reaction was done by adding 1 μL cDNA, 1 μL forward primer, 1 μL reverse primer, 12.5 μL SYBR Premix Ex Taq, and 9.5 μL of nuclease-free water to give the reaction the final volume of 25 μL. The thermal profile for RT-PCR was 95 °C for 3 min, followed by 40 cycles at 95 °C for 10 s, 60 °C for 30 s, and 72 °C for 40 s. Each mRNA level was expressed as a ratio to β-actin mRNA. Three technical replicates of each RNA sample were performed. Relative mRNA expression for each gene was calculated as a fold change compared with the control group using the 2ΔΔct formula method. *Significant difference with control (p<0.05); **high significant difference with control (p<0.01). Two-way ANOVA was used followed by Tukey test. The represented values are the fold change of mRNA expression compared to control.

Figure 4:

Effect of caffeine on the gene expression of AD-involved genes at 24, 96, and 168 hpf.

Bars represent the means±SE. RT-PCR (qPCR) was performed according to Takara Bio guidelines. A 25-μL RT-PCR reaction was done by adding 1 μL cDNA, 1 μL forward primer, 1 μL reverse primer, 12.5 μL SYBR Premix Ex Taq, and 9.5 μL of nuclease-free water to give the reaction the final volume of 25 μL. The thermal profile for RT-PCR was 95 °C for 3 min, followed by 40 cycles at 95 °C for 10 s, 60 °C for 30 s, and 72 °C for 40 s. Each mRNA level was expressed as a ratio to β-actin mRNA. Three technical replicates of each RNA sample were performed. Relative mRNA expression for each gene was calculated as a fold change compared with the control group using the 2ΔΔct formula method. *Significant difference with control (p<0.05); **high significant difference with control (p<0.01). Two-way ANOVA was used followed by Tukey test. The represented values are the fold change of mRNA expression compared to control.

Discussion

Caffeine was suggested as an effective therapeutic agent against AD. Confirmed genetic susceptibility factors for AD were studied in this present work. We analyzed the expression of APP, Psen1, Psen2, ApoE, and Sorl1 genes in developing zebrafish embryos at 24, 96, and 168 hpf after exposure to two different concentrations of caffeine, 10 and 100 μM. We also studied the effect on the expression of two cell communication systems associated to AD, adenosinergic and dopaminergic systems, by analyzing the expression of their receptors. We found that all tested genes are already expressed at early phases of development, with a pattern of fluctuation during the development and as a result of caffeine treatment.

First, it was reasonable to use 100-μM concentration of caffeine because it has no effects on the locomotor activity and does not promote significant embryotoxicity or phenotypic features [25, 26].

To study the direct effect of caffeine on AD gene expression, we choose a package of genes that have confirmed role in AD. The APP gene provides instructions for making a protein called amyloid precursor protein. This protein is found in many cells including the brain and the spinal cord. The normal functions of APP are not fully understood, but increasing evidence suggests that it has important roles in regulating neuronal survival, neurite outgrowth, synaptic plasticity, and cell adhesion [27]. A fundamental abnormality that plays a pivotal role in the dysfunction and death of neurons in AD is altered proteolytic processing of APP, resulting in increased production and accumulation of neurotoxic forms of Aβ in the brain. The evidence supporting the “amyloid hypothesis” of AD is extensive and has been reviewed [28]. The gene expression levels of APP and Psen1 in the peripheral blood samples of patients with AD and their association with the disease are significantly high in AD patients than normal people [29]. Central to the disease is the altered proteolytic processing of APP, the genes involved in the amyloid pathway, which results in the production and aggregation of neurotoxic forms of Aβ. In our study, we found that caffeine has a direct effect on those genes because it down-regulated their expression during the early developmental stages of zebrafish embryos. The significant up-regulation in APP and Psen1 expression occurred at 96 hpf, but after the completion of the neurodevelopment, caffeine significantly down-regulated their expression, compared with control.

We also found that caffeine regulates the expression of Psen2 gene. This gene is known for its role in processing amyloid precursor protein [30]. Research suggests that Psen2 works with other enzymes by cutting the amyloid precursor protein into smaller segments (peptides), β-amyloid peptide and soluble amyloid precursor protein (sAPP); the latter has growth-promoting properties and may play a role in the formation of neurons in the brain both before and after birth. Other functions of sAPP and β-amyloid peptide are under investigation [31, 32]. The up-regulation of this gene after caffeine treatment may increase the formation of neurons and/or help the generation of substantial numbers of new neurons in humans [33, 34].

The most widely studied risk factor for sporadic AD is ApoE [11]. ApoE gene mutation is predictive of AD [35]. A significant reduction in Sorl1 expression, the receptor of ApoE gene, has been found in the brain tissue of AD patients [36]. The ApoE receptor has also been linked to the regulation of APP; faulty processing of which is implicated in AD [13]. A more recent study by a group of international researchers supports the proposition that Sorl1 plays a part in the development of AD in seniors, the findings being significant across racial and ethnic strata [37, 38]. In addition to the link between Sorl1 and β-amyloid, there is a connection between Sorl1 and the ApoE gene known to influence the risk of developing AD [39]. The protein Sorl1 is a receptor that binds itself to a nearby molecule and then causes a reaction within the cell. The interactions between Sorl11 and ApoE have been surprisingly elusive [39]. However, it is difficult to believe that the functional links are merely coincidental. In this research, we observed that exposure to caffeine led to the down-regulation of Sorl1, but exposure to caffeine did not cause down-regulation of its target gene, ApoE. In contrast, we found that the expression of ApoE was not significantly affected by caffeine treatment at 168 hpf at the two tested concentrations (0.94-fold change), compared with control; however, the expression of Sorl1 gene, which is associated with the amyloid pathway, was down-regulated (0.8-fold change), compared with control. Accordingly, the continuous exposure to caffeine may protect and maintain the ApoE gene expression, which stems from the reduction of its receptor expression after completed neurodevelopment, and this may support the idea of that long-term intake of caffeine in moderate levels may protect against neurosystemic inflammation [40, 41].

Accordingly, caffeine has positive affect against AD through the reduction of the expression of the genes associated with the disease. Also, continuous exposure to caffeine may have a positive impact against the expression behavior of the APP and Psen1 genes.

In order to study the correlation between caffeine and cell communication systems, we first studied the appeal of caffeine for AR. We analyzed the optical density of mRNA expression of three zebrafish adenosines, A2aa, A2ab, and A2b. We found that caffeine up-regulated the expression of A2aa and A2ab at 24 hpf. Up-regulation of AR after the exposure to an antagonist is a known event described to occur in low intensities in a variety of species [42, 43]. In zebrafish embryos, the effects of caffeine on the studied genes appear to be selective to A1 and A2aa, which is probably because of the high affinity of these receptors to caffeine [44]. A2a is the highest affinity receptor for caffeine in rodents and humans, while in zebrafish, we do not have this information. Additionally, zebrafish have two clones of A2a with high similarity to the human A2a [45]. According to our results, A2aa and A2ab may also have higher affinity for caffeine in developing zebrafish. This phenomenon must be confirmed by further experiments and studies.

The interaction between ARs and the dopaminergic system after caffeine exposure was studied in our present research. Wide research indicates that the neuromodulator adenosine interacts with dopamine A in the regulation of various behavioral functions, including locomotion [46–48]. Our tested concentrations have no effect on the locomotor activity of developing zebrafish, but we found that A2aa and A2ab up-regulation at 24 hpf causes a reduction in the expression of both DRs, especially at higher caffeine concentrations. Continuous exposure to caffeine up-regulated the expression of both DRs at 96 and 168 hpf, whereas the expression of ARs was significantly down-regulated at 100-μM caffeine concentration. This phenomenon shows the ability of adenosine A2a antagonists to reverse the locomotor suppression that results from interference with dopamine transmission. Thus, caffeine can cause a stimulatory effect on the DR gene expression at later stages of zebrafish development and can be reasonable a therapeutic target for protection against AD. Hence, the stimulation of DRs is also an important event associated to AD; thus, dopamine is particularly involved in the regulation of cognitive processes associated with AD. The non-cognitive aspects of AD are usually linked to dopamine and serotonin, as these neurotransmitters most directly influence mood and emotional balance. According to previous research, dopamine may be low in people with AD [49]. Here we confirm that continuous exposure to caffeine stimulates the expression of DRs, and this may give an indirect protective effect against AD.

Conclusions

This is the first study on newly confirmed molecular factors in developing zebrafish. This model is promising because all tested genes are already expressed at early phases of development. Taking all the results together, we suggest that caffeine may protect against AD, directly via the regulation of amyloid pathway-involved genes and indirectly via stimulation of AR and DRs.


Correspondence: Prof. Jae-Hak Park, Laboratory Animal Medicine, College of Veterinary Medicine, Seoul National University, 151-742 Dae-hak dong, Gwanak-Gu, Seoul, Republic of Korea, Tel.: +82-2-880-1256, E-Mail:

Acknowledgments

This work was supported by the BK21 Program for Veterinary Sciences, Department of Laboratory Animal Medicine, and in part by the Research Institute for Veterinary Sciences, Seoul National University. The authors are grateful to the IDB Fellowship.

Author contributions: All the authors have accepted responsibility for the entire content of this submitted manuscript and approved submission.

Research funding: None declared.

Employment or leadership: None declared.

Honorarium: None declared.

Competing interests: The funding organization(s) played no role in the study design; in the collection, analysis, and interpretation of data; in the writing of the report; or in the decision to submit the report for publication.

References

1. Arendash GW, Cao CJ. Caffeine and coffee as therapeutics against Alzheimer’s disease. J Alzheimer’s Dis 2010;20:117–26.10.3233/JAD-2010-091249Search in Google Scholar

2. Goedert M, Spillantini MG. A century of Alzheimer’s disease. Science 2006;314:777–81.10.1126/science.1132814Search in Google Scholar

3. Mark PM. Pathways towards and away from Alzheimer’s disease. Nature 2004;430:631–39.10.1038/nature02621Search in Google Scholar

4. Xiong L, Gaspar C, Rouleau GA. Genetics of Alzheimer’s disease and research frontiers in dementia. Ger Aging 2005;8:31–5.Search in Google Scholar

5. Verdile G, Martins R. Molecular genetics of Alzheimer’s disease. Mol Biol Neuropsychiatry Dis 2008;23:229–76.10.1007/978-3-540-85383-1_8Search in Google Scholar

6. Selkoe D J, Schenk D. Alzheimer’s disease: molecular understanding predicts amyloid-based therapeutics. Annu Rev Pharmacol Toxicol 2003;43:545–84.10.1146/annurev.pharmtox.43.100901.140248Search in Google Scholar

7. Goldgaber D, Lerman MI, McBride OW, Saffiotti U, Gajdusek DC. Characterization and chromosomal localization of a cDNA encoding brain amyloid of Alzheimer’s disease. Science 1987;235:877–80.10.1126/science.3810169Search in Google Scholar

8. Tanzi RE, Gusella JF, Watkins PC, Bruns GA, St George-Hyslop P, Van Keuren ML, et al. Amyloid beta protein gene: cDNA, mRNA distribution, and genetic linkage near the Alzheimer locus. Science 1987;235:880–4.10.1126/science.2949367Search in Google Scholar

9. Guo Q, Wang Z, Li H, Wiese M, Zheng H. APP physiological and pathophysiological functions: insights from animal models. Cell Res 2012;22:78–89.10.1038/cr.2011.116Search in Google Scholar

10. Tedde A, Nacmias B, Ciantelli M, Forleo P, Cellini E, Bagnoli S, et al. Identification of new presenilin gene mutations in early-onset familial Alzheimer disease. Arch Neurol 2003;60:1541–4.10.1001/archneur.60.11.1541Search in Google Scholar

11. Prasanthi JR, Dasari B, Marwarha G, Larson T, Chen X, Geiger JD, et al. Caffeine protects against oxidative stress and Alzheimer’s disease-like pathology in rabbit hippocampus induced by cholesterol-enriched diet. Free Radic Biol Med 2010;49:1212–20.10.1016/j.freeradbiomed.2010.07.007Search in Google Scholar

12. Suh YH, Checler F. Amyloid precursor protein, presenillin, and alpha-synuclein: molecular pathogenesis and pharmacological applications in Alzheimer’s disease. Pharmacol Rev 2006;58:280.Search in Google Scholar

13. Scherzer CR, Offe K, Gearing M. Loss of apolipoprotein E receptor LR11 in Alzheimer disease. Arch Neurol 2004;61:1200–5.10.1001/archneur.61.8.1200Search in Google Scholar

14. Lele Z, Krone PH. The zebrafish as a model system in developmental, toxicological and transgenic research. Biotechnol Adv 1996;14:57–72.10.1016/0734-9750(96)00004-3Search in Google Scholar

15. Vascotto SG, Beckham Y, Kelly GM. The zebrafish’s swim to fame as an experimental model in biology. Biochem Cell Biol 1997;75:479–85.10.1139/o97-081Search in Google Scholar

16. Ivetac I, Becanovic J, Krishnapillai V. Zebrafish: genetic tools and genomics; Asia-Pacific. J Mol Biol Biotechnol 2000;8:1–11.Search in Google Scholar

17. Bowman TV, Zon LI. Swimming into the future of drug discovery: in vivo chemical screens in zebrafish; ACS. Chem Biol 2010;5:159–61.Search in Google Scholar

18. Wendy B, Jessica P, Matthew W. Identification of zebrafish A2 adenosine receptors and expression in developing zebrafish embryos. Gene Expr Pattern 2009;9:144–51.10.1016/j.gep.2008.11.006Search in Google Scholar

19. Jacobson KA, Gao ZG. Adenosine receptors as therapeutic targets. Nat Rev Drug Discov 2006;5:247–64.10.1038/nrd1983Search in Google Scholar

20. Cunh RA. Adenosine as a neuromodulator and as a homeostatic regulator in the nervous system: different roles, different sources and different receptors. Neurochem Int 2001;38:107–25.10.1016/S0197-0186(00)00034-6Search in Google Scholar

21. Fredholm BB, Chen JF, Masino SA, Vaugeois JM. Actions of adenosine at its receptors in the CNS: insights from knockouts and drugs. Annu Rev Pharmacol Toxicol 2005;45:385–412.10.1146/annurev.pharmtox.45.120403.095731Search in Google Scholar

22. Anisur R. The role of adenosine in Alzheimer’s disease. Neuropharmacology 2009;7:207–16.10.2174/157015909789152119Search in Google Scholar

23. Westerfield M. The zebrafish book, guide for the laboratory use of zebrafish brachydanio rerio. Eugene (OR): University of Oregon Press 1995.Search in Google Scholar

24. Abdelkader TS, Chang SN, Kim TH, Song J, Kim DS, Park JH. Exposure time to caffeine affects heartbeat and cell damage-related gene expression of zebrafish Danio rerio embryos at early developmental stages. J Appl Toxicol 2013;33:1277–83.Search in Google Scholar

25. Chen YH, Huang YH, Wen CC, Wang YH, Chen WL, Chen LC, et al. Movement disorder and neuromuscular change in zebrafish embryos after exposure to caffeine. Neurotoxicol Teratol 2008;30:440–7.10.1016/j.ntt.2008.04.003Search in Google Scholar

26. Selderslaghs IW, Van-Rompay AR, De-Coen W. Development of a screening assay to identify teratogenic and embryotoxic chemicals using the zebrafish embryo. Reprod Toxicol 2011;28:308–20.10.1016/j.reprotox.2009.05.004Search in Google Scholar

27. Mattson MP. Cellular actions of beta-amyloid precursor protein and its soluble and fibrillogenic derivatives. Physiol Rev 1997;77:1081–132.10.1152/physrev.1997.77.4.1081Search in Google Scholar

28. Hardy J. Amyloid, the presenilins and Alzheimer’s disease. Trends Neurosci 1997;20:154–59.10.1016/S0166-2236(96)01030-2Search in Google Scholar

29. Zhang Y, Qian YP, Jiang KD, Yu SY, Wang DX, Zhang MY, et al. Expression levels of APP and PS1 genes in patients with Alzheimer’s disease. Yi Chuan 2006;28:525–34.Search in Google Scholar

30. Gerrish A, Russo G, Richards A, Moskvina V, Ivanov D, Harold D, et al. The role of variation at AβPP, PSEN1, PSEN2, and MAPT in late onset Alzheimer’s disease. J Alzheimer’s Dis 2012;28:377–87.10.3233/JAD-2011-110824Search in Google Scholar

31. Das HK. Transcriptional regulation of the presenilin-1 gene: implication in Alzheimer’s disease. Front Biosci 2008;13:822–32.10.2741/2723Search in Google Scholar

32. Melnik BC, Plewig G. Impaired Notch signalling: the unifying mechanism explaining the pathogenesis of hidradenitis suppurativa (acne inversa). Br J Dermatol 2013;168:876–8.10.1111/bjd.12068Search in Google Scholar

33. Wade N. Brain may grow new cells daily. The New York Times 1999. Available at: . The New York Times Company.Search in Google Scholar

34. Nowakowski RS. Stable neuron numbers from cradle to grave. Proc Natl Acad Sci USA 2006;103:33.10.1073/pnas.0605605103Search in Google Scholar

35. Wade N. Study detects a gene linked to Alzheimer’s. The New York Times 2007. Available at: . The New York Times Company.Search in Google Scholar

36. Andersen OM, Reiche J, Schmidt V, Gotthardt M, Spoelgen R, Behlke J, et al. Neuronal sorting protein-related receptor sorLA/LR11 regulates processing of the amyloid precursor Protein. Proc Natl Acad Sci USA 2005;102:13461–7.10.1073/pnas.0503689102Search in Google Scholar

37. Rogaeva E, Meng Y, Lee JH, Yongjun Gu, Kawarai T, Zou F, et al. The neuronal sortilin-related receptor SORL1 is genetically associated with Alzheimer disease. Nat Genet 2007;39:168–77.10.1038/ng1943Search in Google Scholar

38. Hall J. Canadian-led team links gene to Alzheimer’s. Toronto Star. Retrieved 2007. Available at: . Copyright Toronto Star Newspapers Ltd. 1996–2015.Search in Google Scholar

39. Dodson SE, Andersen OM, Karmali V, Fritz JJ, Cheng D, Peng J, et al. Loss of LR11/SORLA enhances early pathology in a mouse model of amyloidosis: evidence for a proximal role in Alzheimer’s disease. J Neurosci 2008;28:12877–86.10.1523/JNEUROSCI.4582-08.2008Search in Google Scholar

40. Ross GW, Abbott RD, Petrovitch H, Abbott RD, Petrovitch H, Morens DM, et al. Association of coffee and caffeine intake with the risk of Parkinson disease. J Am Med Assoc 2000;283:2674–9.10.1001/jama.283.20.2674Search in Google Scholar

41. Thompson R, Keene K. The pros and cons of caffeine. Br Psychol Soc 2004;17:698–701.Search in Google Scholar

42. Adén U, Herlenius E, Tang L-Q, Fredholm BB. Maternal caffeine intake has minor effects on adenosine receptor ontogeny in the rat brain. Pediatr Res 2000;48:177–83.10.1203/00006450-200008000-00010Search in Google Scholar

43. León D, Albasanz JL, Ruíz MA, Fernández M, Martín M. Adenosine A1 receptor down regulation in mothers and fetal brain after caffeine and theophylline treatments to pregnant rats. J Neurochem 2002;82:625–34.10.1046/j.1471-4159.2002.01008.xSearch in Google Scholar

44. Fredholm BB, Karl B, Janet H, Astrid N, Edwin EZ. Actions of caffeine in the brain with special reference to factors that contribute to its widespread use. Pharmacol Rev 1999;51:83–133.Search in Google Scholar

45. Boehmler W, Petko J, Woll M, Frey C, Thisse B, Thisse C, et al. Identification of zebrafish A2 adenosine receptors and expression in developing embryos. Gene Expr Patterns 2009;9:144–52.10.1016/j.gep.2008.11.006Search in Google Scholar

46. Antoniou K, Papadopoulou-Daifoti Z, Hyphantis T, Papathanasiou G, Bekris E, Marselos M, et al. A detailed behavioral analysis of the acute motor effects of caffeine in the rat: involvement of adenosine A1 and A2A receptors. Psychopharmacology (Berl) 2005;183:154–62.10.1007/s00213-005-0173-6Search in Google Scholar

47. Ferré S, Fredholm BB, Morelli M, Popoli P, Fuxe K. Adenosine-dopamine receptor-receptor interactions as an integrative mechanism in the basal ganglia. Trends Neurosci 1997;20:482–7.10.1016/S0166-2236(97)01096-5Search in Google Scholar

48. Fuxe K, Ferre S, Genedani S, Franco R, Agnati LF. Adenosine receptor-dopamine interactions in the basal ganglia and their relevance for brain function. Physiol Behav 2007;92:210–7.10.1016/j.physbeh.2007.05.034Search in Google Scholar

49. Lifen Z, Fu-Ming Z, John A. Drugs for Alzheimer’s disease enhance in vitro dopamine release. Mol 2004;66:538–44.10.1124/mol.104.000299Search in Google Scholar

Received: 2015-2-28
Accepted: 2015-4-21
Published Online: 2015-5-15
Published in Print: 2015-6-1

©2015 by De Gruyter

This article is distributed under the terms of the Creative Commons Attribution Non-Commercial License, which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.