Skip to content
BY-NC-ND 3.0 license Open Access Published by De Gruyter July 25, 2019

An analysis and survey of interleukin-10 receptor mutation in inflammatory bowel disease (IBD) in the first Iranian IBD cohort

Razieh Khoshnevisan, Fariba Vakili, Christoph Klein, Daniel Kotlarz, Maryam Nasirian, Roya Sherkat and Abbas Rezaei

Abstract

Background

Early-onset inflammatory bowel disease (IBD) is classified into Crohn’s disease (CD), ulcerative colitis (UC) and unclassified disorders, which has a chronic, relapsing course and can result in substantial long-term morbidity. IBD is a multifactorial disorder with genetic susceptibility, immunological predisposition and environmental triggers. The objective of this study was to generally determine the prevalence of IL10R mutation in IBD patients in Isfahan, Iran. We performed sequencing of all exons in IL10RA and IL10RB in a cohort of IBD patients and healthy controls.

Methods

Total DNA contents of 76 patients and 50 healthy controls were extracted from whole blood and polymerase chain reaction (PCR) amplifications and sequencing of whole exons in IL10R were performed.

Results

Overall, we determined 13 single nucleotide polymorphisms (SNPs) in all IL10R genes. Of them, rs3135932 and rs2229113 of the IL10RA1 gene, in exons 4 and 7, respectively, were significantly associated with IBD occurrence in patients.

Conclusions

Our results also confirmed that early-onset IBD could be attributed to a synergistic effect of several variant alleles of the genes encoding IL10 receptors. These variants, alone, could only give rise to a sub-clinical manifestation of IBD.

Reviewed Publication:

Klein H.-G. Edited by:


Introduction

Inflammatory bowel disease (IBD) is classified into Crohn’s disease (CD), ulcerative colitis (UC) and unclassified disorders, which has a chronic, relapsing period and may result in substantial long-term morbidity [1]. IBD is a multi-factorial disorder with genetic susceptibility, immunological predisposition and environmental triggers [2]. To date, more than 210 genetic loci have been associated with IBD [3], [4]. Genetic loci implicated in IBD show several pathways that are crucial for intestinal homeostasis, barrier function, epithelial restitution, microbial defense, innate immune regulation, reactive oxygen species (ROS) generation, autophagy, regulation of adaptive immunity, endoplasmic reticulum (ER) stress and metabolic pathways associated with cellular homeostasis [2], [5].

In IBD, monogenic causes need special consideration. In order to identify high risk patients, specific surveillance (e.g. for malignancy or infection) or specific treatments (e.g. bone marrow transplant) are required [1].

Causative variants of monogenic conditions in interleukin-10 (IL10), IL-10 receptor (IL10R), X-linked inhibitor of apoptosis protein (XIAP), ADAM metallopeptidase domain 17 (ADAM17), neutrophil cytosolic factor 4 (NCF4) and tetratricopeptide repeat domain 7A (TTC7A) were identified in very early-onset IBD (VEOIBD) patients; the data presenting the hypothesis that severe infantile colitis frequently start immediately after birth might represent a group of heterogeneous monogenetic diseases [6]. Among these candidate genes, IL-10 and IL-10R gene mutations have been extensively investigated [7]. IL-10 is an anti-inflammatory cytokine secreted by a variety of cell types and is necessary for maintaining immune homeostasis in the gastrointestinal (GI) tract.

IL-10 has a role in restricting T cell proliferation, downregulating costimulatory protein expression in antigen-presenting cells and limiting pro-inflammatory cytokine production [8].

It is well known that substantial geographical and ethnical variations in IBD incidence exist worldwide. The incidence of IBD is steadily rising in many regions of the world. In Iran, however, the incidence and prevalence rates of IBD are not available. So, we established the first IBD bio-bank in Iran [8] and the registration process of IBD patients is ongoing.

Single nucleotide polymorphisms (SNPs) that affect IL-10 production have been associated with CD and/or UC. As far as we know, there are no data available for the evaluation of IL10R mutation in IBD patients in Iran. Hence, the focus was placed on patient’s candidate gene study by sequencing of IL10RA and IL10RB in IBD patients.

Materials and methods

Patient information

We enrolled a total of 76 IBD patients in this study with informed consent. They were referred to the Immunodeficiency Research Center and Al-Zahra University Hospital at the Isfahan University of Medical Sciences. Diagnosis of IBD was based on standard tools including clinical features, endoscopy with biopsies and adequate imaging of the small bowel. We collected their clinical characteristics, including disease type, sex, age of onset and disease behavior. In addition, information pertaining to family history, medical treatment and surgical intervention including the patient’s age at operation and history of infections were also obtained. Furthermore, history of immunodeficiency and autoimmunity in the patients was considered.

DNA extraction and PCR amplification

Total DNA content of each patient was extracted from whole blood using the QIAamp DNA Blood Mini Kit (#51104, Qiagen, Hilden, Germany). A 20-μL polymerase chain reaction (PCR) reaction mixture contained 100 ng of genomic DNA, 2.5 pmol of each of specific primers for each exon, 100 μmol/L deoxyribonucleotide triphosphate (dNTP), 1.5 mmol/L MgCl2 and 1 U of AmpliTaq polymerase (PR901643, Cinnagene, Iran).

Amplifications were performed for all primers using a Bio-RADT100™ thermal cycler (Hercules, CA, USA) according to the following parameters: initial denaturation was done at 95 °C for 5 min, followed by 30 cycles of denaturation at 95 °C for 30 s, annealing at 59 °C for 30 s and elongation at 72 °C for 1 min and ending with a final elongation cycle at 72 °C for 10 min. These conditions were used for all primer pairs.

The resulting PCR product was visualized on a 1% agarose-ethidium bromide gel under ultraviolet (UV) illumination. Five microliters of each reaction was sent for Sanger sequencing and the results were evaluated using the code codon aligner software. Primer set used for PCR reaction was used according to Kotlarz et al.’s paper [2] (Table 1).

Table 1:

Primer set used for PCR.

Name of primer5′→3′
IL10RA 1-FGACAGTGGTTCCCCGTCC
IL10RA 1-RCACTGGATGGAGAACTTTAATGG
IL10RA 2-FGAACCTCCCTTTCTTCTTTGG
IL10RA 2-RAGGCAGGTATCTTCCCATGC
IL10RA 3-FGGCCTCTTGCGTCTCCC
IL10RA 3-RGCAGACATGGTGAGCTATGG
IL10RA 4-FTCCGTGGACTAATTGTTCTGC
IL10RA 4-RAGTCCATAAGGTGCTGCCAC
IL10RA 5-FAAGTCTAAAACGGCTATTATCACTG
IL10RA 4-FTCCGTGGACTAATTGTTCTGC
IL10RA 4-RAGTCCATAAGGTGCTGCCAC
IL10RA5-FAAGTCTAAAACGGCTATTATCACTG
IL10RA 5-RAGCTGGAATTTGAGTTGGATG
IL10RA 6-FGGCTCTGTTTTCAGGGATTG
IL10RA 6-RCATGTTGTCTGGAATTGGGC
IL10RA 7-6-RTCCCACACATTATTACCCTCC
IL10RB 1-FAGGGTAAAGAAGACCCTCAAA
IL10RB 1-RCCTAGTTGCGTCTCAGCAG
IL10RB 2-FGGAGAACCAAGTGCTGGATG
IL10RB 2-RCAGACTCCCTTCCTCCTGTG
IL10RB 3-FTTAACACAGTTTCCACTCCCG
IL10RB 3-RAAGGCCATCCATTTGTGG
IL10RB 4-FTCCGTGGACTAATTGTTCTGC
IL10RB 4-RAGTCCATAAGGTGCTGCCAC
IL10RB 5-FAAGTCTAAAACGGCTATTATCACTG
IL10RB 5-RAGCTGGAATTTGAGTTGGATG
IL10RB 6-FGGCTCTGTTTTCAGGGATTG
IL10RB 6-RCATGTTGTCTGGAATTGGGC
IL10RB 7-1FTCCAGCCAGGAGTTCTGTG
IL10RB 7-1RGCTGAAAATTACACTCTCAGTGG
IL10RB 7-2FCTCCCAGACCCTGGACTTAG
IL10RB 7-2RTCACTTTGTCACCCAGGC
IL10RB 7-3FGATGGCGCATGCCTATAATC
IL10RB 7-3RTGGACATCAAGATGGCAAAC

Statistical analysis

We used StataCorp software (version 11, StataCorp, College Station, TX, USA) for data analysis and described variables as frequency, percentage, mean and standard deviation. Comparative analysis was done via T-test and χ2 test in order to explore the effects of variables on IBD incidence. The incidence of SNPs and consanguinity percentage in patients and healthy controls were compared using χ2-test. We considered a significant level of 5% for all analyses.

Written informed consent

DNA Sanger sequencing of genes encoding for IL-10R1, IL-10R2 and IL-10 was performed upon written informed consent.

Results

We sequenced the genes encoding for all exons IL10RA and IL10RB in 76 patients with IBD and 50 healthy controls in Isfahan, Iran, using the candidate gene sequencing approach. Patients were stratified according to gender, age at diagnosis, therapy response, presence of immunodeficiency and autoimmunity and consanguinity condition. Diagnosis of CD and UC was based on standard clinical, endoscopic and histological criteria [9] and the phenotype characteristics were defined according to the Montreal classification [10] through which 16 IBD patients were diagnosed as having CD and 60 IBD patients as having UC. The study patients represented a subgroup of 12 patients with defined primary immunodeficiency and 26 patients with a history of autoimmunity who presented with onset of severe endoscopically and histopathologically confirmed colitis. In this study, we included patients with routine immunosuppressive therapy regimen (56 patients) and also patients resistant to immunosuppressive therapy (14 patients). Furthermore, we registered the consanguinity condition in 34 patients and 14 healthy donors.

Main clinical characteristics of the patients included in the study are presented in Table 2.

Table 2:

Main clinical characteristics of IBD patients and HCs.

CD (%)UC (%)HC (%)
Number166050
Female, n (%)10 (62.5)26 (43.3)26 (52.0)
Male, n (%)6 (37.5)34 (56.7)24 (48.0)
Age, years, mean (SD)22 (12.5)21 (15.1)19 (16.4)
Age at diagnosis, years, mean (SD)16.6 (10.3)13 (6.5)
Corticosteroid-dependent, n (%)12 (75)44 (73.3)
Corticosteroid-refractory, n (%)4 (25)17 (26.7)
Autoimmunity, n (%)4 (25)22 (36.6)
Immunodeficiency, n (%)2 (12.5)10 (16.6)
Consanguinity, n (%)10 (62.5)24 (40.0)17 (34)

  1. CD, Crohn’s disease; UC, ulcerative colitis; HC, healthy control.

We identified 13 SNPs in all the IL10R exons in our IBD patient cohort and healthy controls.

Identified SNPs in IL10RA were rs2228055, rs752413943, rs2256111, rs3135932, rs145975996, rs755029073, rs2229113, rs747711495, rs200254237, rs746081732, rs751283486 and rs768512760 and in IL10RB, rs2834167.

SNP functions were in following order: missense (I 224 Val), missense (Ala 153Val), synonymous (Ala153Ala), missense (Ser159Gly), missense (Arg263Gln), missense (Arg284Cys), missense (Arg351Gly), synonymous (Gln376Gln), missense (Thr416Ile), missense (Ala493Val), synonymous (Ala511Ala), synonymous (Ser563Ser) and missense (K47E).

The findings indicate that the frequencies of SNPs rs3135932 and rs2229113 in IL10RA are significantly different in IBD patients compared to healthy controls (p-value: 0.003 and 0.009, respectively).

A statistical analysis was conducted to compare patients from consanguine families with those from non-consanguine ones with regard to the two SNPs rs3135932 and rs2229113. The rationale behind the selection of the above SNPs lies in their statistically high correlation with IBD incidence in patients. Interestingly, a significantly higher rate of the incidence of SNPs was observed in patients from consanguine families (p-value=0.001).

In contrast, SNPs rs2228055, rs752413943, rs2256111, rs145975996, rs755029073, rs747711495, rs200254237, rs746081732, rs751283486 and rs768512760 of the IL10RA1 and IL10RB1 genes were not significantly different in patients compared to healthy controls; all those consisting of single base pair substitutions were identified and confirmed by direct sequencing (Table 3).

Table 3:

Frequency of SNPs in IBD patients.

SNPChr. positionAllelesAncestral allelePrevalence in patientsPrevalence in healthy donorsp-Value (χ2 test)Previous IBD report
rs2834167117994131A/AA300.150[11]
rs2228055117994131AG100.409[12]
rs752413943117993331C/TNot reported2330.009Not reported
rs2256111117993332A/GA25430.000Not IBD reported
rs3135932117993348A/GA1100.003[13]
rs145975996117995688A/GG510.226[12]
rs755029073117998754C/TNot reported100.409Not IBD reported
rs2229113117998955A/GG2380.009[14]
rs747711495117999032A/GNot reported3120.000[14]
rs200254237117999151C/TC400.095Not IBD reported
rs746081732117999382C/TNot reported1120.000Not reported
rs751283486117999437C/TNot reported1310.000Not reported
rs768512760117999593A/GNot reported1200.000Not reported

  1. Chr., chromosome.

Discussion

In this case-control study, we determined the frequency of SNPs in the IL10R gene in IBD patients and healthy controls from Iran. The polymorphism rs3135932 in exon 4 and rs2229113 in exon 7 of the IL10RA1 gene were significantly associated with IBD incidence in patients.

In contrast, polymorphisms in the IL10R gene (rs752413943, rs2256111, rs755029073, rs200254237, rs746081732, rs751283486, rs768512760) were not associated with any form of IBD.

The immune response has evolved to protect the host from a broad range of pathogenic microorganisms, control immune responses and prevent reactivity to self, all required to limit host damage in order to maintain hemostasis [15].

Intestinal homeostasis is a highly dynamic process requiring sensitivity to mount appropriate immune responses toward microbial or food antigens, yet necessitating the regulation of these responses in order to prevent chronic inflammation.

Cytokines have an important role in the pathogenesis of IBD; they control multiple aspects of the inflammatory response. In particular, the imbalance between pro-inflammatory and anti-inflammatory cytokines in IBD could cause the resolution of inflammation and tissue destruction [16].

IL-10 as an anti-inflammatory cytokine plays a role in maintaining gut homeostasis [15] secreted by various cells, including monocytes, macrophages, T and B lymphocytes, dendritic cells, epithelial cells and mast cells. IL10 mediates its anti-inflammatory effects through IL-10R-dependent signals emanating from the cell surface.

The IL-10R is a hetero-tetramer that consists of two subunits of IL-10Rα and two subunits of IL-10Rβ. The IL-10Rα subunit is unique for IL-10 signaling, but the IL-10Rβ subunit is shared by IL-22, IL-26 and interferon (IFN)-λ receptor [17]. After binding IL-10 to its receptor, it activates JAK1 and Tyk2, leading to the phosphorylation of STAT-3, the activation of downstream target genes and finally the expression of anti-inflammatory effectors [7].

In the study by Shim and Seo [11], the incidence of p.(T84I) was reported as a trigger to IBD pathogenesis. Moran et al. confirmed the association of p.(I224V) variant with IBD. The study by Glocker et al. indicated that IBD may be a monogenic disorder and homozygous mutations of p.(W159X) in IL-10RB were found in Kurdish siblings with consanguineous parents [18]. Interestingly, similar to Glocker et al.’s report, this variant was detected in nine patients of consanguineous origin in our IBD cohort. In our study, we could find p.(T84I), p.(I224V) and p.(W159X) variants in our patients. Genetic alteration which is caused by p.(R263Q) variant can affect IL10 receptor intracellular signaling and is related to IBD pathogenesis [14]. In five patients, P.(R263Q) variant was detected in our study. P.(R351Q) genetically predisposed IBD incidence [15], the very variant that we also determined in our cohort which was significantly associated with IBD initiation in our study. To the best of our knowledge, P.(A153V), P.(A153A), P.(R284C), P.(T416I), P.(A493V), P.(A511A) and P.(S563S) variants were not reported in IBD patients.

SNPs that affect IL-10 production have been associated with CD and/or UC. For the first time, our results confirmed that early-onset IBD could be attributed to a synergistic effect of several variant alleles of the genes encoding IL10 receptors in Iranian IBD patients. These variants, alone, could only give rise to a sub-clinical manifestation of IBD.

Conclusions

In Iran, as a result of a high rate of consanguinity, the incidence of genetic disorders is relatively high; therefore, evaluation of IL10R mutation in IBD patients is necessary. This recommendation may help patients to have precise diagnosis and tailed therapy.

Funding source: University of Medical Science, Isfahan, Iran

Award Identifier / Grant number: 293217

Funding statement: This study was supported by the University of Medical Science, Isfahan, Iran (Grant No. 293217).

  1. Author contributions: R.K.H., F.V. and S.N. designed and performed experiments and evaluated and interpreted data; M.N. carried out statistical analyses; M.E., H.S., H.T. and P.A. referred patients to our hospital; M.Y., N.N. and M.B., collected clinical data and samples, and screened cohorts. R.S.H., A.R., D.K. and C.K. gave conceptual advice. All the authors have accepted responsibility for the entire content of this submitted manuscript and approved submission.

  2. Employment or leadership: None declared.

  3. Honorarium: None declared.

  4. Competing interests: The funding organization(s) played no role in the study design; in the collection, analysis, and interpretation of data; in the writing of the report; or in the decision to submit the report for publication.

References

1. Ashton JJ, Ennis S, Beattie RM. Early-onset paediatric inflammatory bowel disease. Lancet Child Adolesc Health 2017;1:147–58.10.1016/S2352-4642(17)30017-2Search in Google Scholar

2. Kotlarz D, Beier R, Murugan D, Diestelhorst J, Jensen O, Boztug K, et al. Loss of interleukin-10 signaling and infantile inflammatory bowel disease: implications for diagnosis and therapy. Gastroenterology 2012;143:347–55.10.1053/j.gastro.2012.04.045Search in Google Scholar

3. Schwerd T, Pandey S, Yang H-T, Bagola K, Jameson E, Jung J, et al. Impaired antibacterial autophagy links granulomatous intestinal inflammation in Niemann–Pick disease type C1 and XIAP deficiency with NOD2 variants in Crohn’s disease. Gut 2017;66:1060–73.10.1136/gutjnl-2015-310382Search in Google Scholar

4. Luo Y, de Lange KM, Jostins L, Moutsianas L, Randall J, Kennedy NA, et al. Exploring the genetic architecture of inflammatory bowel disease by whole-genome sequencing identifies association at ADCY7. Nat Genet 2017;49:186–92.10.1038/ng.3761Search in Google Scholar

5. Khor B, Gardet A, Xavier RJ. Genetics and pathogenesis of inflammatory bowel disease. Nature 2011;474:307–17.10.1038/nature10209Search in Google Scholar

6. Avitzur Y, Guo C, Mastropaolo LA, Bahrami E, Chen H, Zhao Z, et al. Mutations in tetratricopeptide repeat domain 7A result in a severe form of very early onset inflammatory bowel disease. Gastroenterology 2014;146:1028–39.10.1053/j.gastro.2014.01.015Search in Google Scholar

7. Zhu L, Shi T, Zhong C, Wang Y, Chang M, Liu X. IL-10 and IL-10 receptor mutations in very early onset inflammatory bowel disease. Gastroenterol Res 2017;10:65–9.10.14740/gr740wSearch in Google Scholar

8. Sherkat R, Rostami S, Yaran M, Emami MH, Saneian H, Tavakoli H, et al. Establishment and development of the first biobank of inflammatory bowel disease, suspected to primary immunodeficiency diseases in Iran. Advanced Biomed Res 2018;7:45.10.4103/abr.abr_278_16Search in Google Scholar

9. Van Assche G, Dignass A, Panes J, Beaugerie L, Karagiannis J, Allez M, et al. The second European evidence-based consensus on the diagnosis and management of Crohn’s disease: definitions and diagnosis. J Crohn Colitis 2010;4:7–27.10.1016/j.crohns.2009.12.003Search in Google Scholar

10. Satsangi J, Silverberg MS, Vermeire S, Colombel JF. The Montreal classification of inflammatory bowel disease: controversies, consensus, and implications. Gut 2006;55:749–53.10.1136/gut.2005.082909Search in Google Scholar

11. Shim JO, Seo JK. Very early-onset inflammatory bowel disease (IBD) in infancy is a different disease entity from adult-onset IBD; one form of interleukin-10 receptor mutations. J Hum Genet 2014;59:337.10.1038/jhg.2014.32Search in Google Scholar

12. Lin Z, Wang Z, Hegarty JP, Lin TR, Wang Y, Deiling S, et al. Genetic association and epistatic interaction of the interleukin-10 signaling pathway in pediatric inflammatory bowel disease. World J Gastroenterol 2017;23:4897–909.10.3748/wjg.v23.i27.4897Search in Google Scholar

13. Grundtner P, Gruber S, Murray SS, Vermeire S, Rutgeerts P, Decker T, et al. The IL-10R1 S138G loss-of-function allele and ulcerative colitis. Genes Immun 2008;10:84.10.1038/gene.2008.72Search in Google Scholar

14. Girardelli M, Vuch J, Tommasini A, Crovella S, Bianco AM. Novel missense mutation in the NOD2 gene in a patient with early onset ulcerative colitis: causal or chance association? Int J Mol Sci 2014;15:3834–41.10.3390/ijms15033834Search in Google Scholar

15. Saraiva M, O’Garra A. The regulation of IL-10 production by immune cells. Nat Rev Immunol 2010;10:170.10.1038/nri2711Search in Google Scholar

16. Neurath MF. Cytokines in inflammatory bowel disease. Nat Rev Immunol 2014;14:329.10.1038/nri3661Search in Google Scholar

17. Shouval DS, Biswas A, Goettel JA, McCann K, Conaway E, Redhu NS, et al. Interleukin-10 receptor signaling in innate immune cells regulates mucosal immune tolerance and anti-inflammatory macrophage function. Immunity 2014;40:706–19.10.1016/j.immuni.2014.03.011Search in Google Scholar

18. Glocker EO, Kotlarz D, Klein C, Shah N, Grimbacher B. IL-10 and IL-10 receptor defects in humans. Ann N Y Acad Sci 2011;1246:102–7.10.1111/j.1749-6632.2011.06339.xSearch in Google Scholar

Received: 2019-01-08
Accepted: 2019-06-07
Published Online: 2019-07-25
Published in Print: 2019-08-27

© 2019 Walter de Gruyter GmbH, Berlin/Boston

This article is distributed under the terms of the Creative Commons Attribution Non-Commercial License, which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Scroll Up Arrow