Skip to content
BY 4.0 license Open Access Published by De Gruyter Open Access October 17, 2023

Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice

  • Shuang Liu , Min Liu , Jinnan Zhong , Shi Chen , Ziming Wang , Xiaoyan Gao and Fajiu Li EMAIL logo
From the journal Open Medicine

Abstract

We elucidated the effect of S100A4 on airway remodeling by regulating airway inflammation and epithelial–mesenchymal transition (EMT) in mouse models of asthma. Asthmatic mouse models were established by sensitization and challenged with ovalbumin (OVA). Anti-S100A4 antibody or control IgG antibody was administered daily before the OVA challenge. After the last challenge, airway inflammation and airway hyperresponsiveness were measured; lung tissues and bronchoalveolar lavage fluid (BALF) were harvested. Lung tissue sections were stained and evaluated for pathological changes. Levels of inflammatory cytokines were measured using ELISA. Levels of S100A4 and EMT markers were determined via western blotting analysis. Human bronchial epithelial cells were stimulated with 100 mg/mL house dust mites (HDMs) to evaluate the effect of S100A4 downregulation on EMT in vitro. S100A4 was increased in lung tissues and BALF from asthmatic mice. The asthmatic mice presented airway hyperresponsiveness, airway inflammation, and airway remodeling. After anti-S100A4 antibody administration, pathophysiological signs, including airway hyperresponsiveness and increased infiltration of inflammatory cells, were attenuated. Additionally, anti-S100A4 administration downregulated vimentin and α-SMA expression and upregulated E-cadherin expression in OVA-challenged mice. S100A4 downregulation also inhibited EMT process in HDM-stimulated 16HBE cells. Anti-S100A4 antibody administration alters airway remodeling by preventing EMT in mouse models of asthma.

1 Introduction

Asthma is a common airway condition characterized by reversible airway obstruction, irreversible airway remodeling, and airway inflammation [1,2]. It is a heterogeneous disorder involving different endotypes and phenotypes [3]. Airway remodeling induced by chronic inflammation is an important characteristic in the pathogenesis of asthma, characterized by subepithelial collagen, goblet cell hyperplasia, and smooth muscle hyperplasia, which is considered to be responsible for persistent airflow obstruction and irreversible airway hyperresponsiveness [4,5]. Preventing accelerated airway remodeling is a critical treatment target of asthma due to the minimal effects of current treatments on airway remodeling [6]. Persistent chronic airway inflammation in asthma induces the conversion of epithelial cells to active mesothelial cells, which is the pathological manifestation of epithelial–mesenchymal transition (EMT). This suggests that EMT is implicated in the progression of subepithelial fibrosis and airway remodeling in asthma [7]. During the process of EMT, epithelial marker E-cadherin is downregulated and mesenchymal marker such as α-SMA and vimentin is upregulated, ultimately resulting in impaired airway barrier function and aggravated airway stenosis [8,9]. Therefore, the possible mechanisms related to the link between airway remodeling and EMT need to be fully clarified.

As a member of the S100 calcium-binding family [10], S100A4 is widely expressed in various types of cells, including macrophages, endothelial cells, lymphocytes, neutrophils, fibroblasts, and smooth muscle cells [11,12]. S100A4 interacts with multiple intracellular targets that regulate cell survival, differentiation, growth, and cytoskeletal dynamics [11]. The S100 proteins including S100A4 can be secreted extracellularly by a range of cell types to affect cellular activities in an autocrine or paracrine manner [11,13]. Current studies on S100A4 have mainly focused on its role in regulating tumorigenesis and cancer metastasis [10]. However, emerging evidence has shown that S100A4, as a candidate gene in allergic condition, is involved in pathological inflammatory conditions, such as experimental autoimmune encephalomyelitis, fibrotic disease, cardiovascular disease, and rheumatoid arthritis [1417]. S100A4 was found to be elevated in the nasal mucus of allergic individuals [18] and in the sputum of asthmatic patients [19]. High level of S100A4 was found in the lung of mouse models with allergic asthma; additionally, the administration of S100A4-neutralizing antibodies in mice decreased inflammatory cell infiltration and accumulation in the lung and bronchoalveolar lavage fluid (BALF) [19]. Recent reports have indicated that S100A4 activates proinflammatory pathways in airway smooth muscle tissues [20], and it is critical for mast cell activation in mouse models of allergic asthma [21]. Moreover, evidence shows that the S100A4-mediated EMT displays a key role in tumor development and non-tumor pathophysiology [16]. Downregulation of S100A4 attenuates cardiac fibrosis by inhibiting extracellular matrix deposition and α-SMA expression [22,23]. However, whether S100A4 mediates the EMT in asthma remains unclear.

Here, we hypothesized that S100A4 affects airway remodeling by regulating EMT process. To determine this, we used a mouse model of asthma and 16HBE cell line to analyze the effect of S100A4 in asthma. We applied anti‐S100A4 antibody administration in vivo or transfection technology to silence S100A4 in vitro to observe changes in EMT markers.

2 Materials and methods

2.1 Animals

Forty male BALB/c mice between 6 and 8 weeks of age (25 ± 2 g) were used in this research. The animals were supplied by Vital River Co. Ltd. (Beijing, China). All mice were healthy, and they were maintained under standard laboratory conditions in a 12 h light/dark cycle at 20 ± 3°C. They were fed with commercial pellets and had free access to water. Prior to the experiment, they were quarantined for 7 days to be acclimatized. Efforts were made to alleviate any suffering of the animals. All experimental protocols were conducted following the institution’s ethical guidelines and were approved by the Ethics Commission of Affiliated Hospital of Jianghan University (Hubei, China).

2.2 Asthma sensitization and challenge with ovalbumin (OVA)

Forty male BALB/c mice were assigned into four groups: control, OVA, OVA + isotype antibody, and OVA + anti-S100A4, with ten animals for each group. The asthma model was established as described previously, with minor modifications [24]. Briefly, on days 0, 7, and 14, animals were intraperitoneally sensitized with 200 µl of solution (10 µg OVA emulsified in 1 mg aluminum hydroxide) (Sigma, MO, USA). Between days 21 and 28, animals were challenged with 5% OVA for 30 min daily. Mice in the control received phosphate-buffered saline (PBS) for sensitization and stimulation. Mice were injected intraperitoneally with 100 µg/body of a neutralizing mouse monoclonal IgG1 antibody specific for S100A4 (clone 6B12) or with the corresponding mouse monoclonal IgG1 isotype control (clone MOPC-21, BP0083, BioXcell, NH, USA) at the same concentration for 30 min before the OVA challenge. Isolation and characterization of 6B12 anti-S100A4 mouse monoclonal antibody were described as reported [25]. The schematic experimental protocol for drug administration and timeline is shown in Figure 1a.

Figure 1 
                  High expression levels of S100A4 in OVA‐induced asthmatic mice. (a) The schematic experimental protocol for drug administration and timeline. (b) Immunohistochemistry analysis of S100A4 in lung tissue sections from OVA‐induced murine asthmatic models. (c) RT-qPCR and (d and e) western blotting analyses of S100A4 expression in lung tissues from OVA mice and PBS control mice. N = 10 for each group. **
                     p < 0.1.
Figure 1

High expression levels of S100A4 in OVA‐induced asthmatic mice. (a) The schematic experimental protocol for drug administration and timeline. (b) Immunohistochemistry analysis of S100A4 in lung tissue sections from OVA‐induced murine asthmatic models. (c) RT-qPCR and (d and e) western blotting analyses of S100A4 expression in lung tissues from OVA mice and PBS control mice. N = 10 for each group. ** p < 0.1.

2.3 Hyperresponsiveness measurement

Twenty‐four hours following the final OVA challenge, airway hyperresponsiveness in response to acetylcholine chloride (3.125, 6.25, 12.5, and 25 mg/mL; Sigma) was detected using a whole-body plethysmography (Buxco Electronics, NY, USA). The detailed procedure was described previously [26].

2.4 BALF collection and cell count

Twenty‐four hours following the final OVA challenge, the mice were sacrificed. PBS (100 mL) was used to wash the pulmonary circulation. To collect the BALF, right bronchus was ligated, and left bronchus was flushed three times with 3 mL of PBS via a catheter; the fluid recovery rate was 80%. Cell suspension was centrifuged at 500 g for 10 min at 4°C. Cell pellet was resuspended in 1 mL of normal saline. A total number of cells in 0.05 mL BALF were counted with a hemocytometer (Baxter Diagnostics, USA). The inflammatory cells were dried and stained with Wright-Giemsa (Solarbio, Beijing, China) following the manufacturer’s instructions and were counted based on conventional morphological criteria. Differential cell counts were obtained by counting at least 400 cells per slide. All counts were conducted with blind methods. The remaining BALF supernatants were maintained at −80°C for next use.

2.5 ELISA

The concentrations of IL-4, IL-13, TNF-α, and IL-1β in BALF were measured with mouse ELISA kits (R&D Systems, MN, USA) following the manufacturer’s instructions. The optical density for the ELISA was detected using a microplate reader.

2.6 Histological staining

Lung tissues were fixed and embedded in paraffin. Then, the blocks were cut into 5 μm-thick sections and subjected to hematoxylin–eosin (H&E) staining according to routine procedures. The severity degree of inflammation was graded referring to previously described scoring criteria [27]. Staining analyses were performed from five randomly selected fields (200× magnification).

2.7 RT-qPCR

Total RNA was extracted from lung sections using TRIzol (Invitrogen, USA). The optical density was measured by a spectrophotometer (Bio-Rad, USA) at 260 and 280 nm. RNA was reverse transcribed using commercially reverse transcription kits (Qiagen, Hilden, Germany). Real‐time PCR was performed using ABI PRISM 7500 Real-time PCR System (ABI, CA, USA) and SYBR Premix EX Taq (Takara, Japan). S100A4 expression was determined using the threshold cycle value normalized against GAPDH expression. The used primer sequences are as follows: S100A4: 5′‐ATTTCTGCCAGAGCCGCTTCTACT‐3′ (forward) and 5′‐CAGTTTGTATCCGGCAAACTAGTA‐3′ (reverse), and GAPDH: 5′‐AGGTCGGTGTGAACGGATTTG‐3′ (forward) and 5′‐TGTAGACCATGTAGTTGAGGTCA‐3′ (reverse).

2.8 Cell treatment and transfection

Human bronchial epithelial cell line 16HBE (ATCC, USA) was cultured in RPMI 1640 medium (Invitrogen) containing 8% FBS (Gibco, USA). Cells were maintained at 37°C in a humid atmosphere containing 5% CO2, and cell growth was observed under a microscope. When cells reached 90% confluence, they were subjected to trypsin digestion. Cells were treated with 100 mg/mL house dust mites (HDMs; STALLERGENES GREER, Lenoir, NC, USA) for 24 h. 16HBE cells were transfected with shRNAs to generate the negative control shRNA (sh-NC) group and S100A4-knockdown (sh-S100A4; GeneChem, Shanghai, China) group. Transfection was performed using Lipofectamine 3000 (Invitrogen) following the manufacturer’s instructions.

2.9 Western blotting

Total proteins from cells or tissues were extracted as previously described [28]. Bradford methods (Bio-Rad) were applied to determine protein concentrations. The samples were separated by 8, 10, or 12% SDS-PAGE and electro-transferred to PVDF membranes. After blocking with 5% skim milk for 1.5 h, the membranes were probed with S100A4 (1:1,000; 13018), E-cadherin (1:1,000; 3195), α-SMA (1:1,000; 19245), and vimentin (1:1,000; 5741) overnight at 4°C with GAPDH (1:1,000; 5174) as a loading control. All antibodies are supplied by Cell Signaling Technology. After incubation with corresponding secondary antibodies for 1.5 h at room temperature, an enhanced chemiluminescence reagent (Santa Cruz, CA, USA) was used for color development.

2.10 Statistical analysis

All data were processed using SPSS 18.0 (SPSS Inc., Chicago, USA) and are expressed as mean ± standard deviation. Pairwise comparisons were performed using Student’s independent t-test and comparisons among multiple groups using one-way ANOVA. The value of p < 0.05 indicated statistical significance.

3 Results

3.1 Increased expression levels of S100A4 in OVA‐induced asthmatic mice

Immunohistochemistry analysis showed weak S100A4 expression in a number of inflammatory cells including macrophages and granulocytes in mice from the control group. However, mice in the asthma mouse model group had moderate expression levels of S100A4 in inflammatory and vascular smooth muscle cells, with prominent S100A4 expression in granulocytes. In addition, S100A4 was weakly stained in a number of epithelial cells in asthmatic mice. Compared to control mice, the number of positive stained S100A4 cells was significantly increased in asthmatic mice (Figure 1b). Additionally, both mRNA and protein levels of S100A4 were notably higher in the lung of asthmatic mice than those of control mice (Figure 1c–e). Forty male BALB/c mice were assigned into four groups: control, OVA, OVA + isotype antibody, and OVA + anti-S100A4, with ten animals for each group.

3.2 Treatment with anti‐S100A4 inhibits airway hyperresponsiveness and inflammation in OVA-challenged mouse models

ELISA showed that OVA-challenged mice had a higher level of S100A4 in BALF than control mice. Anti‐S100A4 administration markedly reduced S100A4 expression level in BALF (Figure 2a). We evaluated the effect of anti-S100A4 on airway hyperresponsiveness in response to acetylcholine chloride. Baseline airway resistance had no significant differences among all groups. Acetylcholine chloride at doses increasing progressively significantly increased lung resistance in OVA mice compared to control mice. However, anti‐S100A4 administration resulted in a marked reduction of lung resistance in OVA mice (Figure 2b), suggesting that anti‐S100A4 inhibited airway hyperresponsiveness. Following the OVA challenge, the increased number of total cells, as well as neutrophils, eosinophils, and lymphocytes in BALF, was found (Figure 2c). ELISA showed upregulated levels of TNF-α, IL-1β, IL-4, and IL-13 in BALF induced by OVA (Figure 2d). However, the number of inflammatory cells and inflammatory cytokines was significantly reduced after anti‐S100A4 administration (Figure 2c and d). This suggested that anti‐S100A4 suppressed airway inflammation in OVA mice.

Figure 2 
                  Treatment with anti‐S100A4 inhibits airway hyperresponsiveness and inflammation in BALF from OVA-challenged mouse models. Forty male BALB/c mice were assigned into four groups: control, OVA, OVA + isotype antibody, and OVA + anti-S100A4. (a) ELISA of S100A4 levels in BALF. (b) Airway hyperresponsiveness in each group. (c) The number of total inflammatory cells and cellular components in BALF. (d) ELISA of TNF-α, IL-1β, IL-4, and IL-13 levels in BALF. N = 10 for each group. **
                     p < 0.1 vs the control group; ##
                     p < 0.1 vs the OVA group.
Figure 2

Treatment with anti‐S100A4 inhibits airway hyperresponsiveness and inflammation in BALF from OVA-challenged mouse models. Forty male BALB/c mice were assigned into four groups: control, OVA, OVA + isotype antibody, and OVA + anti-S100A4. (a) ELISA of S100A4 levels in BALF. (b) Airway hyperresponsiveness in each group. (c) The number of total inflammatory cells and cellular components in BALF. (d) ELISA of TNF-α, IL-1β, IL-4, and IL-13 levels in BALF. N = 10 for each group. ** p < 0.1 vs the control group; ## p < 0.1 vs the OVA group.

3.3 Treatment with anti‐S100A4 alleviates airway inflammation in OVA-challenged mouse models

Airway inflammation was further assessed using histopathological analyses of lung tissues. H&E staining showed that OVA-challenged mice presented massive peribronchial and perivascular infiltration of inflammatory cells, accompanied by increased inflammation score compared with control mice. However, anti‐S100A4 administration decreased infiltration of inflammatory cells and inflammation score caused by OVA (Figure 3a and b).

Figure 3 
                  Treatment with anti‐S100A4 alleviates airway inflammation in OVA-challenged mouse models. (a) Infiltration of inflammatory cells in lung tissues was evaluated using H&E staining. Magnification: 200 ×. Scale bar: 50 µm. (b) Inflammation score. N = 10 for each group. **
                     p < 0.1 vs the control group; ##
                     p < 0.1 vs the OVA group.
Figure 3

Treatment with anti‐S100A4 alleviates airway inflammation in OVA-challenged mouse models. (a) Infiltration of inflammatory cells in lung tissues was evaluated using H&E staining. Magnification: 200 ×. Scale bar: 50 µm. (b) Inflammation score. N = 10 for each group. ** p < 0.1 vs the control group; ## p < 0.1 vs the OVA group.

3.4 Treatment with anti‐S100A4 inhibits EMT in asthmatic mice

EMT plays a key role in airway narrowing and obstruction caused by airway remodeling. As shown by western blotting in Figure 4a and b, a significant reduction of the E-cadherin level and an elevation of the α-SMA and vimentin levels were detected in the lung of OVA mice. Following administration of anti-S100A4, the E-cadherin level was upregulated, while the α-SMA and vimentin levels were downregulated, suggesting that the OVA-induced EMT process was inhibited by anti-S100A4.

Figure 4 
                  Treatment with anti‐S100A4 inhibits EMT in asthmatic mice. (a and b) Western blotting analysis of E‑cadherin, α-SMA, and vimentin in lung tissues. N = 10 for each group. **
                     p < 0.1 vs the control group; ##
                     p < 0.1 vs the OVA group.
Figure 4

Treatment with anti‐S100A4 inhibits EMT in asthmatic mice. (a and b) Western blotting analysis of E‑cadherin, α-SMA, and vimentin in lung tissues. N = 10 for each group. ** p < 0.1 vs the control group; ## p < 0.1 vs the OVA group.

3.5 S100A4 downregulation inhibits EMT in HDM-stimulated 16HBE cells

The in vitro effect of S100A4 on EMT was evaluated in HDM-stimulated 16HBE cells. After 16HBE cells were stimulated with 100 ng/mL HDM for 24, 48, and 72 h, western blotting examined the S100A4 level, showing that the S100A4 level had the most significant upregulation at 48 h (Figure 5a and b). 16HBE cells were transfected with sh-NC or sh-S100A4. The protein expression level of S100A4 was lower in cells transfected with sh-S100A4#1 than those with sh-S100A4#2 (Figure 5c and d); therefore, sh-S100A4#1 was applied in subsequent experiments. Western blotting showed that the E-cadherin level was downregulated, while the α-SMA and vimentin levels were upregulated in HDM-stimulated 16HBE cells. As expected, transfection of sh-S100A4#1 markedly upregulated E-cadherin level and downregulated α-SMA and vimentin levels in HDM-stimulated 16HBE cells (Figure 5e and F), suggesting that S100A4 downregulation inhibited EMT in HDM-stimulated 16HBE cells.

Figure 5 
                  S100A4 downregulation inhibits EMT in HDM-stimulated 16HBE cells. (a and b) Western blotting analysis of S100A4 level in 16HBE cells after treatment with 100 ng/mL HDM for 24, 48, and 72 h. (c and d) Western blotting analysis of S100A4 level in 16HBE cells transfected with sh-S100A4 or control. (e and f) Western blotting of E‑cadherin, α-SMA, vimentin, and S100A4 levels in HDM-stimulated 16HBE cells transfected with sh-S100A4 or control. *
                     p < 0.5, **
                     p < 0.1 vs the control or sh-NC group; ##
                     p < 0.1 vs the HDM group.
Figure 5

S100A4 downregulation inhibits EMT in HDM-stimulated 16HBE cells. (a and b) Western blotting analysis of S100A4 level in 16HBE cells after treatment with 100 ng/mL HDM for 24, 48, and 72 h. (c and d) Western blotting analysis of S100A4 level in 16HBE cells transfected with sh-S100A4 or control. (e and f) Western blotting of E‑cadherin, α-SMA, vimentin, and S100A4 levels in HDM-stimulated 16HBE cells transfected with sh-S100A4 or control. * p < 0.5, ** p < 0.1 vs the control or sh-NC group; ## p < 0.1 vs the HDM group.

4 Discussion

Asthma is a chronic airway condition with complex predisposing factors and pathogenesis. Airway remodeling in asthmatic patients is intractable under the current treatment. Reduction of epithelial proteins and elevation of mesenchymal proteins are pathological manifestations of EMT, which occur during the process of airway remodeling. In this study, BALB/c mice were subjected to OVA sanitization to establish animal models of asthma. Based on this model, airway hyperreactivity, airway inflammation, and EMT characteristics were examined in asthmatic mice. We detected elevated levels of S100A4 in the lung and BALF of OVA-challenged mice, suggesting that S100A4 may be associated with the pathogenesis of asthma. The treatment effect of S100A4 on OVA-induced asthma was investigated.

S100A4 has been implicated in the development of several lung diseases. Expression of S100A4 was significantly increased in a dose‐ and time‐dependent manner in lung tissues of bleomycin‐induced murine models for pulmonary fibrosis and localized mainly in lung fibroblasts [29]. S100A4, used as a marker for EMT, stained weakly in a number of biopsy epithelial cells from patients with stable lung allografts [15]. S100A4 mRNA and protein expression were elevated in pulmonary arteries of mice treated with hypoxia. S100A4 protein was specifically localized in vascular smooth muscle cells and fibroblasts as demonstrated by immunohistochemistry analysis [30]. It is unclear what types of cells in the lungs are responsible for S100A4 secretion; however, cell types like pulmonary artery smooth muscle cells [31], fibroblasts [30], and several cancer cells [32] have been identified to secrete S100A4. S100A4 immuno‐staining in lung tissues in our study showed that S100A4‐stained cells were mainly infiltrating inflammatory cells, especially granulocyte and vascular smooth muscle cells. Furthermore, the number of S100A4‐positive cells in the interstitial and peri‐vascular regions was significantly increased in OVA‐induced asthmatic mice compared to control mice. This suggested that inflammatory cells, especially granulocytes and vascular smooth muscle cells, are potential sources of S100A4 in the airway and lungs. However, further studies need to be performed to confirm the cell types responsible for S100A4 secretion and determine the mechanism underlying the secretion process.

In this study, OVA-challenged mice exhibited asthma-like symptoms. Airway hyperreactivity is a main feature of asthma. Acetylcholine chloride at doses increasing progressively significantly increased lung resistance in OVA mice compared to control mice, suggesting that airway hyperreactivity occurred in OVA-challenged mice. Airway inflammation is considered a key trigger for airway hyperreactivity. Proinflammatory cytokines IL-4 and IL-13 secreted by Th2 are closely associated with mucus secretion, eosinophil activation, and airway remodeling in asthma [33,34]. Studies demonstrate that controlling Th2-type asthma is effective via the preparation of anti-IL-4/IL-13 antibodies [35]. S100A4 has been shown to suppress airway inflammation in chronic asthmatic mouse models [19]. In this study, treatment with anti‐S100A4 antibody significantly inhibited Th2-mediated airway hyperreactivity and reduced the production of IL-4 and IL-13. Inflammatory cell infiltration around the airway also aggravates the progression of asthma [36]. Eosinophil gathering around the bronchus and release of cytotoxic granule protein contribute to collagen deposition and epithelial cell injury [33], which is required for airway remodeling. The cytokines (such as IL-1β and TNF-α) are also involved in promoting the allergic response [37]. Therefore, there is ongoing research on how to prevent the release of inflammatory factors [38]. Here, the administration of anti‐S100A4 antibody in vivo alleviated airway remodeling by reducing airway hyperreactivity and inflammation. Extracellular S100A4 can affect numerous cell types by binding to their receptors. Epidermal growth factor receptor (EGFR) [39] and the receptor for advanced glycation end products (RAGE) [40] have been shown to be the extracellular receptors for S100A4. S100A4 can enhance EGFR/ErbB2 receptor signaling pathway to induce cell proliferation and promote tumor progression [39]. In addition, extracellular S100A4 can also interact with RAGE to increase plasmin levels and thus induce tube formation in endothelial cells [40]. More importantly, S100A4 plays a crucial role in leukocyte migration, which has been associated with the pathogenesis of inflammatory diseases. S100A4 can induce the secretion of cytokines, particularly eotaxin‐2 and GM‐CSF from T lymphocytes [41]. We hypothesized that the potential role of S100A4 in asthmatic airway inflammation may be partially attributed to its ability to promote the infiltration of inflammatory cells.

E-cadherin, vimentin, and α-SMA proteins are key markers in the process of EMT [42]. Loss of epithelial cell adhesion protein E-cadherin causes the dysfunction of epithelial barrier, resulting in the loss of structural stability and polarity of the bronchial epithelium, which is required for the migration of bronchial epithelial cells. Increased vimentin and α-SMA expression alters the composition of cytoskeletal proteins and thereby contributes to the epithelial cubic‑shaped cells into fiber‑like cells. These cells thus obtain the potential of migration [43]. It has been suggested that low E-cadherin expression in patients with asthma is related to the dysfunction of airway barrier and the development of airway remodeling [44]. A study reported decreased expression of E-cadherin and elevated expression of vimentin in the airway epithelium from dust mite-induced asthmatic mice [45]. We also found that E-cadherin was downregulated and vimentin and α-SMA were upregulated in OVA-challenged mice and in HDM-stimulated epithelial cells. Although the relationship between S100A4 and airway inflammation was elucidated, whether it affects EMT in asthma remains unknown. S100A4 drives EMT in chronic sinusitis mucosal epithelial cells and accelerates nasal mucosa tissue remodeling [46]. S100A4 silencing inhibits TGF-β-induced EMT in pleural mesothelial cells [47]. In the current study, anti-S100A4 administration downregulated vimentin and α-SMA levels and upregulated E-cadherin level in OVA-challenged mice. S100A4 downregulation also inhibited EMT process in HDM-stimulated 16HBE cells. These findings suggested that silencing S100A4 may be a possible mechanism to prevent the bronchial epithelium from fibrosis in asthma. However, we only investigated the effects of intracellular S100A4 on EMT process in human bronchial epithelial cells. We plan to investigate whether extracellular S100A4 exerts the effects on EMT in vitro in future studies. This will support our data in mouse models.

5 Conclusion

In summary, we verified that S100A4 was elevated in the bronchial epithelium from mouse models of airway remodeling and in human bronchial epithelial cell line stimulated by HDM. Additionally, intracellular S100A4 blockage attenuated airway remodeling by the inhibition of airway inflammation and EMT process, suggesting that S100A4-antibody therapy may have clinical applicability in controlling airway remodeling in patients with asthma. However, further investigations should be conducted to elucidate the mechanisms of S100A4 in asthma.


# These authors contributed equally to this work.


Acknowledgements

Not applicable.

  1. Funding information: This work was supported by Wuhan Municipal Health Commission Clinical Medical Research Project (No. WX20B30).

  2. Author contributions: SL, ML, and FJL were the main designers of this study. JNZ, SC, ZMW, and XYG performed the experiments. SL and ML analyzed the data. FJL drafted the manuscript. All authors read and approved the final manuscript.

  3. Conflict of interest: The authors declare that there is no conflict of interest regarding the publication of this study.

  4. Data availability statement: The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Killeen K, Skora E. Pathophysiology, diagnosis, and clinical assessment of asthma in the adult. Nurs Clin North Am. 2013;48(1):11–23.10.1016/j.cnur.2012.11.001Search in Google Scholar PubMed

[2] Yang IV, Schwartz DA. Epigenetic mechanisms and the development of asthma. J Allergy Clin Immunol. 2012;130(6):1243–55.10.1016/j.jaci.2012.07.052Search in Google Scholar PubMed PubMed Central

[3] Al Heialy S, Ramakrishnan RK, Hamid Q. Recent advances in the immunopathogenesis of severe asthma. J Allergy Clin Immunol. 2022;149(2):455–65.10.1016/j.jaci.2021.12.765Search in Google Scholar PubMed

[4] Prakash YS, Halayko AJ, Gosens R, Panettieri RA Jr., Camoretti-Mercado B, Penn RB. An official American thoracic society research statement: Current challenges facing research and therapeutic advances in airway remodeling. Am J Respir Crit Care Med. 2017;195(2):e4–19.10.1164/rccm.201611-2248STSearch in Google Scholar PubMed

[5] Gras D, Bourdin A, Chanez P, Vachier I. [Airway remodeling in asthma: Clinical and functional correlates]. Med Sci. 2011;27(11):959–65.10.1051/medsci/20112711011Search in Google Scholar PubMed

[6] Menzies-Gow A, Bafadhel M, Busse WW, Casale TB, Kocks JWH, Pavord ID, et al. An expert consensus framework for asthma remission as a treatment goal. J Allergy Clin Immunol. 2020;145(3):757–65.10.1016/j.jaci.2019.12.006Search in Google Scholar PubMed

[7] Fischer KD, Agrawal DK. Vitamin D regulating TGF-β induced epithelial-mesenchymal transition. Respir Res. 2014;15(1):146.10.1186/s12931-014-0146-6Search in Google Scholar PubMed PubMed Central

[8] Ijaz T, Pazdrak K, Kalita M, Konig R, Choudhary S, Tian B, et al. Systems biology approaches to understanding Epithelial Mesenchymal Transition (EMT) in mucosal remodeling and signaling in asthma. World Allergy Organ J. 2014;7(1):13.10.1186/1939-4551-7-13Search in Google Scholar PubMed PubMed Central

[9] Liu T, Liu Y, Miller M, Cao L, Zhao J, Wu J, et al. Autophagy plays a role in FSTL1-induced epithelial mesenchymal transition and airway remodeling in asthma. Am J Physiol Lung Cell Mol Physiol. 2017;313(1):L27–l40.10.1152/ajplung.00510.2016Search in Google Scholar PubMed

[10] Donato R, Cannon BR, Sorci G, Riuzzi F, Hsu K, Weber DJ, et al. Functions of S100 proteins. Curr Mol Med. 2013;13(1):24–57.10.2174/156652413804486214Search in Google Scholar

[11] Ambartsumian N, Klingelhöfer J, Grigorian M. The multifaceted S100A4 protein in cancer and inflammation. Methods Mol Biol (Clifton, NJ). 2019;1929:339–65.10.1007/978-1-4939-9030-6_22Search in Google Scholar PubMed

[12] Boye K, Maelandsmo GM. S100A4 and metastasis: A small actor playing many roles. Am J Pathol. 2010;176(2):528–35.10.2353/ajpath.2010.090526Search in Google Scholar PubMed PubMed Central

[13] Leclerc E, Fritz G, Vetter SW, Heizmann CW. Binding of S100 proteins to RAGE: An update. Biochim Biophys Acta. 2009;1793(6):993–1007.10.1016/j.bbamcr.2008.11.016Search in Google Scholar PubMed

[14] Chen L, Li J, Zhang J, Dai C, Liu X, Wang J, et al. S100A4 promotes liver fibrosis via activation of hepatic stellate cells. J Hepatol. 2015;62(1):156–64.10.1016/j.jhep.2014.07.035Search in Google Scholar PubMed

[15] Lawson WE, Polosukhin VV, Zoia O, Stathopoulos GT, Han W, Plieth D, et al. Characterization of fibroblast-specific protein 1 in pulmonary fibrosis. Am J Respir Crit Care Med. 2005;171(8):899–907.10.1164/rccm.200311-1535OCSearch in Google Scholar PubMed

[16] Fei F, Qu J, Li C, Wang X, Li Y, Zhang S. Role of metastasis-induced protein S100A4 in human non-tumor pathophysiologies. Cell Biosci. 2017;7:64.10.1186/s13578-017-0191-1Search in Google Scholar PubMed PubMed Central

[17] Dierick BJH, van der Molen T, Flokstra-de Blok BMJ, Muraro A, Postma MJ, Kocks JWH, et al. Burden and socioeconomics of asthma, allergic rhinitis, atopic dermatitis and food allergy. Expert Rev Pharmacoeconomics Outcomes Res. 2020;20(5):437–53.10.1080/14737167.2020.1819793Search in Google Scholar PubMed

[18] Bruhn S, Fang Y, Barrenäs F, Gustafsson M, Zhang H, Konstantinell A, et al. A generally applicable translational strategy identifies S100A4 as a candidate gene in allergy. Sci Transl Med. 2014;6(218):218ra4.10.1126/scitranslmed.3007410Search in Google Scholar PubMed PubMed Central

[19] Huang X, Qu D, Liang Y, Huang Q, Li M, Hou C. Elevated S100A4 in asthmatics and an allergen-induced mouse asthma model. J Cell Biochem. 2019;120(6):9667–76.10.1002/jcb.28245Search in Google Scholar PubMed

[20] Wu Y, Zhang W, Gunst SJ. S100A4 is secreted by airway smooth muscle tissues and activates inflammatory signaling pathways via receptors for advanced glycation end products. Am J Physiol Lung Cell Mol Physiol. 2020;319(1):L185–95.10.1152/ajplung.00347.2019Search in Google Scholar PubMed PubMed Central

[21] Wu T, Ma L, Jin X, He J, Chen K, Zhang D, et al. S100A4 is critical for a mouse model of allergic asthma by impacting mast cell activation. Front Immunol. 2021;12:692733.10.3389/fimmu.2021.692733Search in Google Scholar PubMed PubMed Central

[22] Qian L, Hong J, Zhang Y, Zhu M, Wang X, Zhang Y, et al. Downregulation of S100A4 alleviates cardiac fibrosis via Wnt/β-catenin pathway in mice. Cell Physiol Biochem: Int J Exp Cell Physiol Bioch Pharmacol. 2018;46(6):2551–60.10.1159/000489683Search in Google Scholar PubMed

[23] Tamaki Y, Iwanaga Y, Niizuma S, Kawashima T, Kato T, Inuzuka Y, et al. Metastasis-associated protein, S100A4 mediates cardiac fibrosis potentially through the modulation of p53 in cardiac fibroblasts. J Mol Cell Cardiol. 2013;57:72–81.10.1016/j.yjmcc.2013.01.007Search in Google Scholar PubMed

[24] Hou C, Kong J, Liang Y, Huang H, Wen H, Zheng X, et al. HMGB1 contributes to allergen-induced airway remodeling in a murine model of chronic asthma by modulating airway inflammation and activating lung fibroblasts. Cell Mol Immunol. 2015;12(4):409–23.10.1038/cmi.2014.60Search in Google Scholar PubMed PubMed Central

[25] Klingelhöfer J, Grum-Schwensen B, Beck MK, Knudsen RS, Grigorian M, Lukanidin E, et al. Anti-S100A4 antibody suppresses metastasis formation by blocking stroma cell invasion. Neoplasia (New York, NY). 2012;14(12):1260–8.10.1593/neo.121554Search in Google Scholar PubMed PubMed Central

[26] Yao J, Jiang M, Zhang Y, Liu X, Du Q, Feng G. Chrysin alleviates allergic inflammation and airway remodeling in a murine model of chronic asthma. Int Immunopharmacol. 2016;32:24–31.10.1016/j.intimp.2016.01.005Search in Google Scholar PubMed

[27] Zang N, Li S, Li W, Xie X, Ren L, Long X, et al. Resveratrol suppresses persistent airway inflammation and hyperresponsivess might partially via nerve growth factor in respiratory syncytial virus-infected mice. Int Immunopharmacol. 2015;28(1):121–8.10.1016/j.intimp.2015.05.031Search in Google Scholar PubMed

[28] Li LC, Piao HM, Zheng MY, Lin ZH, Choi YH, Yan GH. Ginsenoside Rh2 attenuates allergic airway inflammation by modulating nuclear factor-κB activation in a murine model of asthma. Mol Med Rep. 2015;12(5):6946–54.10.3892/mmr.2015.4272Search in Google Scholar PubMed

[29] Li Y, Bao J, Bian Y, Erben U, Wang P, Song K, et al. S100A4( +) macrophages are necessary for pulmonary fibrosis by activating lung fibroblasts. Front Immunol. 2018;9:1776.10.3389/fimmu.2018.01776Search in Google Scholar PubMed PubMed Central

[30] Ward C, Forrest IA, Murphy DM, Johnson GE, Robertson H, Cawston TE, et al. Phenotype of airway epithelial cells suggests epithelial to mesenchymal cell transition in clinically stable lung transplant recipients. Thorax. 2005;60(10):865–71.10.1136/thx.2005.043026Search in Google Scholar PubMed PubMed Central

[31] Lawrie A, Spiekerkoetter E, Martinez EC, Ambartsumian N, Sheward WJ, MacLean MR, et al. Interdependent serotonin transporter and receptor pathways regulate S100A4/Mts1, a gene associated with pulmonary vascular disease. Circ Res. 2005;97(3):227–35.10.1161/01.RES.0000176025.57706.1eSearch in Google Scholar PubMed

[32] Schneider M, Hansen JL, Sheikh SP. S100A4: A common mediator of epithelial-mesenchymal transition, fibrosis and regeneration in diseases? J Mol Med (Berlin, Ger). 2008;86(5):507–22.10.1007/s00109-007-0301-3Search in Google Scholar PubMed

[33] Manka LA, Wechsler ME. Selecting the right biologic for your patients with severe asthma. Ann Allergy Asthma Immunol. 2018;121(4):406–13.10.1016/j.anai.2018.07.033Search in Google Scholar PubMed

[34] Ramsahai JM, Hansbro PM, Wark PAB. Mechanisms and management of asthma exacerbations. Am J Respir Crit Care Med. 2019;199(4):423–32.10.1164/rccm.201810-1931CISearch in Google Scholar PubMed

[35] Bagnasco D, Ferrando M, Varricchi G, Passalacqua G, Canonica GW. A critical evaluation of Anti-IL-13 and Anti-IL-4 strategies in severe asthma. Int Arch Allergy Immunol. 2016;170(2):122–31.10.1159/000447692Search in Google Scholar PubMed

[36] Mims JW. Asthma: Definitions and pathophysiology. Int Forum Allergy Rhinol. 2015(5 Suppl 1):S2–6.10.1002/alr.21609Search in Google Scholar PubMed

[37] Fahy JV. Type 2 inflammation in asthma--present in most, absent in many. Nat Rev Immunol. 2015;15(1):57–65.10.1038/nri3786Search in Google Scholar PubMed PubMed Central

[38] Barnes PJ. Targeting cytokines to treat asthma and chronic obstructive pulmonary disease. Nat Rev Immunol. 2018;18(7):454–66.10.1038/s41577-018-0006-6Search in Google Scholar PubMed

[39] Klingelhöfer J, Møller HD, Sumer EU, Berg CH, Poulsen M, Kiryushko D, et al. Epidermal growth factor receptor ligands as new extracellular targets for the metastasis-promoting S100A4 protein. FEBS J. 2009;276(20):5936–48.10.1111/j.1742-4658.2009.07274.xSearch in Google Scholar PubMed

[40] Semov A, Moreno MJ, Onichtchenko A, Abulrob A, Ball M, Ekiel I, et al. Metastasis-associated protein S100A4 induces angiogenesis through interaction with Annexin II and accelerated plasmin formation. J Biol Chem. 2005;280(21):20833–41.10.1074/jbc.M412653200Search in Google Scholar PubMed

[41] Grum-Schwensen B, Klingelhöfer J, Grigorian M, Almholt K, Nielsen BS, Lukanidin E, et al. Lung metastasis fails in MMTV-PyMT oncomice lacking S100A4 due to a T-cell deficiency in primary tumors. Cancer Res. 2010;70(3):936–47.10.1158/0008-5472.CAN-09-3220Search in Google Scholar PubMed

[42] Scanlon CS, Van Tubergen EA, Inglehart RC, D’Silva NJ. Biomarkers of epithelial-mesenchymal transition in squamous cell carcinoma. J Dental Res. 2013;92(2):114–21.10.1177/0022034512467352Search in Google Scholar PubMed PubMed Central

[43] Kokkinos MI, Wafai R, Wong MK, Newgreen DF, Thompson EW, Waltham M. Vimentin and epithelial-mesenchymal transition in human breast cancer--observations in vitro and in vivo. Cells Tissues Organs. 2007;185(1–3):191–203.10.1159/000101320Search in Google Scholar PubMed

[44] de Boer WI, Sharma HS, Baelemans SM, Hoogsteden HC, Lambrecht BN, Braunstahl GJ. Altered expression of epithelial junctional proteins in atopic asthma: Possible role in inflammation. Can J Physiol Pharmacol. 2008;86(3):105–12.10.1139/Y08-004Search in Google Scholar PubMed

[45] Fischer KD, Hall SC, Agrawal DK. Vitamin D supplementation reduces induction of epithelial-mesenchymal transition in allergen sensitized and challenged mice. PLoS one. 2016;11(2):e0149180.10.1371/journal.pone.0149180Search in Google Scholar PubMed PubMed Central

[46] Gong N, Shi L, Bing X, Li H, Hu H, Zhang P, et al. S100A4/TCF complex transcription regulation drives epithelial-mesenchymal transition in chronic sinusitis through Wnt/GSK-3β/β-catenin signaling. Front Immunol. 2022;13:835888.10.3389/fimmu.2022.835888Search in Google Scholar PubMed PubMed Central

[47] Ning Q, Li F, Wang L, Li H, Yao Y, Hu T, et al. S100A4 amplifies TGF-β-induced epithelial-mesenchymal transition in a pleural mesothelial cell line. J Invest Med. 2018;66(2):334–9.10.1136/jim-2017-000542Search in Google Scholar PubMed PubMed Central

Received: 2022-05-18
Revised: 2022-11-21
Accepted: 2022-11-28
Published Online: 2023-10-17

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Downloaded on 3.3.2024 from https://www.degruyter.com/document/doi/10.1515/med-2022-0622/html
Scroll to top button