WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4

2.1 Bioinformation analysis

We conducted bioinformation analysis through GEPIA (http://gepia.cancer-pku.cn/) to analyze expression level and survival in TCGA database.

2.2 Antibodies and plasmids

The p-Super shRNA plasmids were bought from Addgene and constructed by our lab. The plasmids including pcDNA3.1 and pcDNA3.1-WDR79 were constructed in our lab.

2.3 Cell culture and transfection

The HPAC, Capan-1, SW1990, and CFPAC-1, and normal pancreatic cell line such as hTERT-HPNE, were purchased from American Type Culture Collection and maintained in Dulbecco’s modified Eagle’s medium (with 10% of fetal bovine serum) at 37°C in a 5% CO₂ incubator.

2.4 Immunoblot assay

Samples were lysed by RIPA buffer (9800; Cell Signaling). All the cell and tissue samples were isolated to extract the proteins, separated by 10% SDS-polyacrylamide gel electrophoresis, then transferred onto polyvinylidene fluoride membranes and blocked with 10% fat-free milk in TBS with Tween-20 buffer. All membranes were subsequently incubated with the indicated primary antibodies targeted a series of proteins for 2 h. Subsequently, the membranes were incubated with secondary antibodies for 1 h. Blots were then measured.

2.5 qPCR

qPCR was performed with the SYBR-Green Master Mix (Roche, USA) and respective primers. The used primers were listed as below: WDR79: F: 5′-AATCAGCGCATCTACTTCGAT-3′, R: 5′-AAATCGAAGTAGATGCGCTGA-3′, GAPDH: F: AGAAGGCTGGGGCTCATTTG, R: AGGGGCCATCCACAGTCTTC′.

2.6 Cell counting kit-8 (CCK-8) assay

PDAC cells were plated into the 96-well plates with a density of 1,000 cell per well and maintained for 24, 48, 72, and 96 h. Cells were then incubated with CCK-8 for 4 h and the OD value at the wavelength of 450 nm was measured.

2.7 Transwell assays

Cells transfected with indicated plasmids were plated into the upper chamber of transwell chambers in culture medium without serum. Then, medium containing 10% FBS was added into the bottom to stimulate motility. After 24 h, cells in the upper chamber were removed, and the remaining cells were fixed, as well as stained with 0.2% crystal violet.

2.8 Glucose intake test

The glycolysis levels of cells were detected according to the glucose intake (ab136955), which was measured by the corresponding kits bought from Abcam according to the relevant instructions.

2.9 Oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) test

OCR and ECAR were detected by an XF24 Extracellular Flux Analyzer (Seahorse Bioscience, Billerica, MA, USA) following the manufacture’s guidelines. OCR and ECAR measurement was performed after the exchange of medium for 90 min. The inhibitors of electron transport chain and oxidative phosphorylation (OXPHOS), including oligomycin A (1 μM), CCCP (1.5 μM), rotenone (0.5 μM), and antimycin A (0.5 μM), were injected.

2.10 Statistics

GraphPad 5.0 software was used for the statistical analysis. Data were expressed as mean ± SEM. Student’s t-test was used for the comparisons, and p < 0.05 was considered significant difference.

3.1 WDR79 was highly expressed in human PDAC tissues and cells

We first detected the expression of WDR79 in tumor tissues and cells. We detected the expression of WDR79 in PDAC tissues (n = 179) and normal tissues (171) according to the TCGA database. We found that the expression of WDR79 was high in PDAC tissues of patients (Figure 1a). Subsequently, we detected the mRNA levels and protein levels of WDR79 in PDAC cells including HPAC, Capan-1, SW1990, and CFPAC-1, and normal pancreatic cell line hTERT-HPNE. The qPCR and immunoblot results revealed that the expression of WDR79 was high in both mRNA and protein levels in PDAC cells compared to normal pancreatic cells (Figure 1b and c). Therefore, WDR79 was highly expressed in human PDAC tissues and cells.

Figure 1

WDR79 was highly expressed in pancreatic cancer tissues and cells. (a) TCGA database showed the expression of WDR79 in pancreatic cancer tissues and normal tissues. (b) qPDACR assays showed the mRNA levels of WDR79 in cell lines including hTERT-HPNE, HPAC, Capan-1, SW1990, and CFPAC-1. (c) Immunoblot showed the protein levels of WDR79 in cell lines including hTERT-HPNE, HPAC, Capan-1, SW1990, and CFPAC-1. **p < 0.05, ***p < 0.01. WDR79 vs control; ^# p < 0.01, ^## p < 0.05, ^### p < 0.01. shWDR79 vs shControl.

3.2 WDR79 depletion suppressed viability as well as the motility of PDAC cells

Subsequently, we detected the effects of WDR79 on the viability as well as the motility of PDAC cells. The plasmids and shRNAs of WDR79 were transfected into two types of PDAC cells, including HPAC and Capan-1, to alter the expression of WDR79 in PDAC cells. Immunoblot results revealed the transfection of WDR79 plasmids obviously increased its expression in HPAC and Capan-1 cells, whereas the transfection of WDR79 shRNAs (shRNA 1# and 2#) significantly suppressed the expression of WDR79 in PDAC cells (Figure 2a).

Figure 2

Effects of WDR79 on the viability and motility of pancreatic cancer cells. (a) Immunoblot showed the expression of WDR79 in HPAC and Capan-1 cells upon the indicated transfection. (b) CCK-8 assays showed the OD value at 450 nm wavelength of HPAC and Capan-1 cells upon the indicated transfection at 24, 48, 72, and 96 h. (c) Transwell showed the invasive HPAC and Capan-1 cells upon the transfection of indicated plasmids or shRNAs. (d) Immunoblot showed the expression of E-cadherin and N-cadherin in HPAC and Capan-1 cells upon the indicated transfection. **p < 0.01, ***p < 0.01, WDR79 vs control; ^# p < 0.01, ^## p < 0.05, ^### p < 0.01. shWDR79 vs shControl.

CCK-8 assays showed thatWDR79 overexpression promoted the viability of HPAC and Capan-1 cells, and its depletion suppressed the viability of cells (Figure 2b). Transwell assays suggested that WDR79 overexpression contributed to the migration of HPAC and Capan-1 cells, whereas its knockdown decreased invasive cell numbers of PDAC cells (Figure 2c). Subsequently, immunostaining assays were performed to detect the expression of E-cadherin and N-cadherin, which were two biomarkers of cell motility. We noticed that WDR79 overexpression decreased expression of E-cadherin and increased N-cadherin expression, whereas its depletion (sh 2#) increased E-cadherin and decreased N-cadherin expression in HPAC and Capan-1 cells (Figure 2d). Therefore, WDR79 depletion suppressed viability as well as the motility of PDAC cells.

3.3 WDR79 knockdown inhibited aerobic glycolysis of PDAC cells

Then, the effect of WDR79 on the aerobic glycolysis of PDAC cells was detected. Immunoblot assays were carried out to detect the expression of markers of aerobic glycolysis, including GLUT1, HK2, as well as LDHA in HPAC and Capan-1 cells upon the overexpression and depletion of WDR79. We found that WDR79 overexpression increased the expression of GLUT1, HK2, as well as LDHA, and the depletion of WDR79 suppressed the expression of these proteins in HPAC and Capan-1 cells (Figure 3a). We subsequently performed glucose uptake assays, and the data confirmed that WDR79 overexpression promoted the glucose uptake in HPAC and Capan-1 cells, whereas its depletion suppressed the glucose uptake (Figure 3b). We then performed OCR and ECAR assays and found that WDR79 overexpression contributed to the OCR and suppressed ECAR in HPAC and Capan-1 cells, which was reversed by the depletion of WDR79 (Figure 3c). Therefore, WDR79 knockdown inhibited the aerobic glycolysis of PDAC cells.

Figure 3

WDR79 knockdown inhibited aerobic glycolysis of pancreatic cancer cells. (a) Immunoblot showed the expression of GLUT1, HK2, LDHA in HPAC, and Capan-1 cells upon the indicated transfection. (b) Glucose uptake assays showed the relative glucose uptake capacity of HPAC and Capan-1 cells upon the indicated transfection. (c) OCR and ECAR levels of HPAC and Capan-1 cells upon the indicated transfection. *p < 0.05, **p < 0.01, ***p < 0.01, WDR79 vs control; ^# p < 0.01, ^## p < 0.05, ^### p < 0.01. shWDR79 vs shControl.

3.4 Depletion of WDR79 increased SIRT4 expression by suppressing UHRF1

Immunoblot assays revealed that WDR79 overexpression increased the expression of UHRF1 and decreased the expression of SIRT4 in HPAC and Capan-1 cells (Figure 4a). The depletion of WDR79 suppressed UHRF1 expression and increased SIRT4 expression in HPAC and Capan-1 cells (Figure 4a). Subsequently, we performed rescue assays. Our data confirmed that UHRF1 overexpression reversed the increase of SIRT4 induced by WDR79 depletion in both HPAC and Capan-1 cells (Figure 4b). We therefore thought that ablation of WDR79 increased SIRT4 expression by suppressing UHRF1 expression.

Figure 4

WDR79 depletion increased SIRT4 expression by inhibiting UHRF1 in pancreatic cancer cells. (a) Immunoblot showed the expression of UHRF1 and SIRT4 in HPAC and Capan-1 cells upon the indicated transfection. (b) Immunoblot showed the expression of UHRF1 and SIRT4 in HPAC and Capan-1 cells upon the indicated transfection. *p < 0.05, **p < 0.01, ***p < 0.01, WDR79 vs control; ^# p < 0.01, ^## p < 0.05, ^### p < 0.01. shWDR79 vs shControl. ^& p < 0.05, ^&&& p < 0.01, UHRF1 vs NC.

3.5 Depletion of SIRT4 expression reversed the effect of WDR79

We then performed immunoblot assays to detect the effects of SIRT4 on the anti-tumor effect of WDR79 in PDAC. We found that WDR79 overexpression decreased SIRT4 expression, whereas SIRT4 shRNA transfection increased SIRT4 expression in WDR79 overexpressed HPAC and Capan-1 cells (Figure 5a). We further performed CCK-8 assays and found that WDR79 depletion suppressed the proliferation of PDAC cells, which was reversed by SIRT4 depletion in WDR79 depleted cells (Figure 5b). Furthermore, transwell assay results suggested that WDR79 depletion suppressed cell motility, which was also reversed by SIRT4 depletion (Figure 5c). In addition, WDR79 depletion suppressed the expression of GLUT1, HK2, as well as LDHA, and the depletion of SIRT4 further reversed the inhibition expression of these proteins (Figure 5d). Therefore, depletion of SIRT4 expression reversed the anti-tumor effect of WDR79.

Figure 5

Depletion of SIRT4 expression reversed the effects of WDR79. (a) Immunoblot showed the expression of SIRT4 in HPAC and Capan-1 cells upon the indicated transfection. (b) CCK-8 assays showed the OD value at 450 nm wavelength of HPAC and Capan-1 cells upon the indicated transfection at 24, 48, 72, and 96 h. (c) Transwell showed the invasive pancreatic cancer cells upon the transfection of indicated plasmids or shRNAs. (d) Immunoblot showed the expression of E-cadherin and N-cadherin in HPAC and Capan-1 cells upon the indicated transfection. *p < 0.05, **p < 0.01, ***p < 0.01, shWDR79 vs shControl; ^# p < 0.01, ^## p < 0.05, ^### p < 0.01. shWDR79 + shSIRT4 vs shWDR79 + shControl.